Resource data sheet
Please review the QC test results indicated by check icon below as well as clone information before placing your order.


Promoter collection, Human ABCB1 promoter

Catalog number RDB07315
Resource name pGL4-phABCB1
Alternative name U2669(2047)-3
Clone info. PCR amplified human ABCB1 promoter sequence was inserted into a firefly luciferase vector. Cloned fragment: 87714385 to 87713167(NC_000007.14); relatively -1062 to +157, where +1 corresponds to 1 nt of NM_001348945.1.
PCR cloning, forward primer: CAAATGACCCTAAATCCCTCA; reverse primer: TCTGGTTGCTTCCTGAAGTG. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human ATP-binding cassette, sub-family B (MDR/TAP), member 1 genomic DNA
Depositor|Developer DNA Bank, |
Other clones in our bank human ABCB1 (NCBI Gene 5243) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB07315 pGL4-phABCB1 Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB07315.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Promoter Collection (Firefly Luciferase) (English text)

Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


Original, user report and related articles
