Resource data sheet
Prev.

pGL4-phIL6

Promoter collection, Human IL6 promoter

Catalog number RDB07313
Resource name pGL4-phIL6
Alternative name U2666 (2044)-7
Clone info. Promoter collection. PCR amplified human IL6 promoter sequence was inserted into a firefly luciferase vector. Genomic DNA (22,725,956 - 22,727,254nt of NC_000007.14) corresponding to 1 to 113nt of NM_000600.4 and 1.2 kb up-stream was cloned.
F-primer: agagctgtctgggtctctgg; R-primer: tcctggaggggagatagagc. Entire sequence of promoter region has not been confirmed.
Vector backbone pGL4.10 [Luc2] (Plasmid)
Selectable markers Amp^r
Gene/insert name Human interleukin 6 (interferon, beta 2) genomic DNA
Depositor DNA Bank, | Pan, Jianzhi |
 
Other clones in our bank human IL6 (NCBI Gene 3569) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07313 pGL4-phIL6 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB07313.pdf from Depositor

Featured content

Featured content Dnaconda's recommendation EXR0043e (English text)
Featured content Dnaconda's recommendation EXR0043j (Japanese text)
Featured content Promoter Collection (Firefly Luciferase) (English text)

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB07313_A3F6p1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: pGL4-4174F RDB07313_A3F6a_2.seq
>07313_07313_A3F6_pGL4-4174F_G07_19.ab1
    1 AATAGGTCAG ACATTTCTCT GGCCTAACTG GCCGGTACCT GAGCTCGCTA GCCTCGAGGA
   61 TAGAGCTGTC TGGGTCTCTG GAGACTGGAG GGACAACCTA GTCTAGAGCC CATTTGCATG
  121 AGACCAAGGA TCCTCCTGCA AGAGACACCA TCCTGAGGGA AGAGGGCTTC TGAACCAGCT
  181 TGACCCAATA AGAAATTCTT GGGTGCCGAC GCGGAAGCAG ATTCAGAGCC TAGAGCCGTG
  241 CCTGCGTCCG TAGTTTCCTT CTAGCTTCTT TTGATTTCAA ATCAAGACTT ACAGGGAGAG
  301 GGAGCGATAA ACACAAACTC TGCAAGATGC CACAAGGTCC TCCTTTGACA TCCCCAACAA
  361 AGAGGTGAGT AGTATTCTCC CCCTTTCTGC CCTGAACCAA GTGGGCTTCA GTAATTTCAG
  421 GGCTCCAGGA GACCTGGGGC CCATGCAGGT GCCCCAGTGA AACAGTGGTG AAGAGACTCA
  481 GTGGCAATGG GGAGAGCACT GGCAGCACAA GGCAAACCTC TGGCACAGAG AGCAAAGTCC
  541 TCACTGGGAG GATTCCCAAG GGGTCACTTG GGAGAGGGCA GGGCAGCAGC CAACCTCCTC
  601 TAAGTGGGCT GAAGCAGGTG AAGAAAGTGG CAGAAGCCAC GCGGTGGCAA AAAGGAGTCA
  661 CACACTCCAC CTGGAGACGC CTTGAAGTAA CTGCACGAAA TTTGAGGATG GCCAGGCAGT
  721 TCTACAACAG CCGCTCACAG GGAGAGCCAG AACACAGAAG AACTCAGATG ACTGGTAGTA
  781 TTACCTTCTT CATAATCCCA GGCTTGGGGG GCTGCGATGG AGTCAGAGGA AACTCAGTTC
  841 AGAACATCTT TGGTTTTTAC AAATACAAAT TAACTGGAAC GCTAAATTCT AGCCTGTTAA
  901 TCTGGTCACT GAAAAAAAAT TTTTTTTTTT TCAAAAAACA TAGCTTTAGC TTATTTTTTT
  961 TCTCTTTGTA AAACTTCGTG CATGACTTCA GCTTTACTCT TTGTCAAGAC ATGCCCAAAG
 1021 TGCTGAGTCA CTATAAAAGA AAAAAAAAGA AAGTAAAAGA GAAGTGATCT GCTCTAGCGC
 1081 TAGCCTCATG ACCGAACTTA GCCTGCACTT TCTCTAGCTG TGTCTGCATG CTAAGGAACG
1141 TTCACATGGC ACCAATCCTT AAATAAGGAT TTTTCA
//
Primer: pGL4-136R RDB07313_A3F6b_2.seq
>07313_07313_A3F6_pGL4-136R_H07_22.ab1
    1 GTTTCAAAGG GTTTTTTGGC AACCTTTCCA TGGTTGGCTT TACCAACAGT AACCGGATTG
   61 CCAAGCTTGG CCGCCGAGGC CAGATCTTGA TTCCTGGAGG GGAGATAGAG CTTCTCTTTC
  121 GTTCCCGGTG GGCTCGAGGG CAGAATGAGC CTCAGACATC TCCAGTCCTA TATTTATTGG
  181 GGGTTGAGAC TCTAATATTG AGACTCATGG GAAAATCCCA CATTTGATAA ATCTTTGTTG
  241 GAGGGTGAGG GTGGGGCCAG AGCGGGTGGG GCTGATTGGA AACCTTATTA AGATTGTGCA
  301 ATGTGACGTC CTTTAGCATG GCAAGACACA ACTAGGGGGA AAAGTGCAGC TTAGGTCGTC
  361 ATTGAGGCTA GCGCTAAGAA GCAGAACCAC TCTTCCTTTA CTTTCTTTTT TTCTTTTATT
  421 AGTGACTCAG CACTTTGGCA TGTCTTGACA AAGAGTAAAG CTGAAGTCAT GCACGAAGTT
  481 TTACAAAGAG AAAAAAAATA AGCTAAAGCT ATGTTTTTTG AAAAAAAAAA AATTTTTTTT
  541 CAGTGACCAG ATTAACAGGC TAGAATTTAG CGTTCCAGTT AATTTGTATT TGTAAAAACC
  601 AAAGATGTTC TGAACTGAGT TTCCTCTGAC TCCATCGCAG CCCCCCAAGC CTGGGATTAT
  661 GAAGAAGGTA ATACTACCAG TCATCTGAGT TCTTCTGTGT TCTGGCTCTC CCTGTGAGCG
  721 GCTGTTGTAG AACTGCCTGG CCATCCTCAA ATTTCGTGCA GTTACTTCAA GGCGTCTCCA
  781 GGTGGAGTGT GTGACTCCTT TTTGCCAACC GCGTGGCTTC TGCCACTTTC TTCACCTGCT
  841 TCAGCCCACT TAGAGGAGGT TGGCTGCTGC CCTGCCCTCT CCCAAGTGAA CCCCTTGGGG
  901 AATCCTCCCA GTGAGGGACT TTTGCTCTCT GTGCCCAGAG GTTTTGCCTT TGTGCTGCCC
  961 AGTGCCTCTC CCCATTGCCC ACTGAAGTCT CTTCACCACT GTTTTCACTG GGGGCACCCT
 1021 GGCATGGGGC CCCAGGTCTC CCTGGAAGCC CTGAAAATAC TGAAGCCACT TTGGTTCAGG
 1081 GCCAGAAAAG GGGGGAGAAT ACTTACTTCA CCCTTCTTTG TGGGGAATGT TCAAAGGAGG
 1141 GAACCTTGTG CATCTTGCAA AAGTTTGGTG ATTTATATCG CTCTCCCATC CTTCCCCTCT
1201 GTATAAGTAC TCTGTGAATA TTGA
//
Primer: pAxCALNL_F1 RDB07313_A3F6c_2.seq
>07313_07313_A3F6_pAxCALNL-F1_D01_04_ABI08.ab1
    1 ACAGGGAATC TTATCATGTC TGCTCGAAGC GGCCGGCCGC CCCGACTCTA GAATTATTAC
   61 ACGGCGATCT TGCCGCCCTT CTTGGCCTTA ATGAGAATCT CGCGGATCTT GCGGGCGTCC
  121 AACTTGCCGG TCAGTCCTTT AGGCACCTCG TCCACGAACA CAACACCACC GCGCAGCTTC
  181 TTGGCGGTTG TAACCTGGCT GGCCACATAG TCCACGATCT CCTTCTCGGT CATGGTTTTA
  241 CCGTGTTCCA GCACGACGAC TGCGGCGGGC AGCTCGCCGG CATCGTCGTC GGGCAGGCCG
  301 GCGACCCCGG CGTCGAAGAT GTTGGGGTGT TGCAGCAGGA TGCTCTCCAG TTCGGCTGGG
  361 GCTACCTGGT AGCCCTTGTA TTTGATCAGG CTCTTCAGCC GGTCCACGAT GAAGAAGTGC
  421 TCGTCCTCGT CCCAGTAGGC GATGTCGCCG CTGTGCAGCC AGCCGTCCTT GTCGATGAGA
  481 GCGTTTGTAG CCTCGGGGTT GTTAACGTAG CCGCTCATGA TCATGGGGCC ACGGACGCAC
  541 AGCTCGCCGC GCTGGTTCAC ACCCAGTGTC TTACCGGTGT CCAAGTCCAC CACCTTAGCC
  601 TCGAAGAAGG GCACCACCTT GCCTACTGCG CCAGGCTTGT CGTCCCCTTC GGGGGTGATC
  661 AGAATGGCGC TGGTTGTTTC TGTCAGGCCG TAGCCCTGGC GGATGCCTGG TAGGTGGAAG
  721 CGTTTGGCCA CGGCCTCACC TACCTCCTTG CTGAGCGGCG CCCCGCCGCT GGCGATCTCG
  781 TGCAAGTTGC TTAGGTCGTA CTTGTCGATG AGAGTGCTCT TAGCGAAGAA GCTAAATAGT
  841 GTGGGCACCA GCAGGGGCAG ATTGAATCTT ATAGTCTTGC AAGCTGCGCA AGAAATAGCT
  901 CCTCCTCGAA GCGGTACATG AGCACGACCC GAAAGCCGCA GATCAAGTAG CCCAGCGTGG
  961 ATGAAACATG CCGAAGCCCG TGGGTGAAAT GGCACCACGG CTGAGGATAG CGGTGTCGGG
 1021 GGATGATCTG GTTTGGCCGA GGATGGGGTC GCGGACAATG ACTGATCGAA CAACAAGCCG
1081 GATGCCGTTG CCGGTTAAGC CTAACGCCCG TTGGGCAAAA TTCGGG
//

Please visit Sequencing and PCR primers for primer information.


References

References

user report Zimmermann, M., Chromatin remodelling and autocrine TNF alpha are required for optimal interleukin-6 expression in activated human neutrophils. Nat. Commun. 6: 6061 (2015). PMID 25616107.

2018.12.10

GNP_filter3_RDBDEP_html_181012.pl