Resource data sheet


Expression vector of human IL8

Catalog number RDB07023
Resource name pCMFlag_hsIL8
Alternative name SET-0201_7
Clone info. Expression vector of human IL8.
Derived from Sugano DMC04644. F-primer: atgacttccaagctggccgtgg; R-primer: ttatgaattctcagccctcttca.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human IL8 cDNA
Depositor DNA Bank, |
Other clones in our bank human IL8 (NCBI Gene 3576) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
(Japanese text [open/close])

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB07023 pCMFlag_hsIL8 DNA solution

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB13985_A6Cep1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward RDB13985_A6Cea.seq
Primer: SV40pro_F_V2 RDB13985_A6Ceb.seq

Please visit plasmidSequencing and PCR primers for primer information.

References and tips

Electronic file

Featured content


user report Yokoyama, C., Interleukin-8 enhances the effect of colchicine on cell death. Biochem Biophys Res Commun. 2017 Feb 9. pii: S0006-291X(17)30286-3 [Epub ahead of print] (2017). PMID 28189686.
