Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pGEM3Zf_hsL-Myctv3

Plasmid vector of human MYC cDNA transcription variant 3.

Catalog number RDB07001
Resource name pGEM3Zf_hsL-Myctv3
Alternative name SET-0253_2
Clone info. Plasmid vector of human MYC cDNA transcription variant 3.
PCR cloning, forward primer: gactacgactcgtaccagcact; reverse primer: tcagccaaagagaggcggagat.
Vector backbone pGEM-3Zf(+) (Plasmid)
Selectable markers Amp^r
Gene/insert name Human v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) transcript variant 3 cDNA
Depositor|Developer Nakamura, Yukio |
 
Other clones in our bank human L-Myc, MYCL (NCBI Gene 4610) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB07001 pGEM3Zf_hsL-Myctv3 Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content


Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


References

Original, user report and related articles


2020.02.22

GNP_filter3_RDBDEP_html_191130.pl