Resource data sheet
Prev.

pCMFlag_hsCAMK2B

Expression vector of human CAMK2B

Catalog number RDB06787
Resource name pCMFlag_hsCAMK2B
Alternative name SET-0275_1
Clone info. Expression vector of human CAMK2B. Expression has not yet been confirmed.
Derived from Sugano CBR08526. F-primer: gccaccacggtgacctgcac; R-primer: tcactgcagcggggccacag. Nucleotide substitution C1051T (H283Y) to NM_172078.1.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human calcium/calmodulin-dependent protein kinase II beta, transcript variant 2 cDNA
Depositor DNA Bank, |
 
Other clones in our bank human CAMK2B (NCBI Gene 816) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06787 pCMFlag_hsCAMK2B DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB06787.pdf from Depositor

Featured content

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References


2018.10.22

GNP_filter3_RDBDEP_html_181012.pl