Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination. icon below as well as clone information before placing your order.
Plasmid vector of human Sox11.
| Catalog number | RDB06758 |
|---|---|
| Resource name | pGEM3Zf_hsSox11 |
| Alternative name | SET-0233_4 |
| Clone info. | Plasmid vector of human Sox11. PCR cloning, forward primer: gtgcagcaggcggagagctt; reverse primer: tcaatatgtgaacaccaggtcggag. |
| Vector backbone | pGEM-3Zf(+) (Plasmid) |
| Selectable markers | Amp^r |
| Gene/insert name | Human SRY (sex determining region Y)-box 11 cDNA |
| Depositor|Developer | Nakamura, Yukio | |
| Other clones in our bank | human sox11 (NCBI Gene 6664) | |
Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
| Terms and conditions set forth by the DEPOSITOR | 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. |
|---|---|
| Ordering | Please visit Information of Request for Distribution. Order form [Credit Card Payment] [Bank Transfer or Check Payment] Material Transfer Agreement (MTA) [Word] |
[open/close]| Catalog # | Resource name | Availability | Shipping form | Fee (non-profit org.) |
|---|---|---|---|---|
| RDB06758 | pGEM3Zf_hsSox11 | Under QC test. Please contact us. | DNA solution |
Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.Electronic file
Original reference
Further references such as user reports and related articles (go to bottom)
Featured content
Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Original, user report and related articles
2020.02.22
GNP_filter3_RDBDEP_html_191130.pl