Plasmid vector of human Sox11
Catalog number | RDB06758 |
---|---|
Resource name | pGEM3Zf_hsSox11 |
Alternative name | SET-0233_4 |
Clone info. | Plasmid vector of human Sox11. F-primer: gtgcagcaggcggagagctt; R-primer: tcaatatgtgaacaccaggtcggag. |
Vector backbone | pGEM-3Zf(+) (Plasmid) |
Selectable markers | Amp^r |
Gene/insert name | Human SRY (sex determining region Y)-box 11 cDNA |
Depositor | Nakamura, Yukio | |
  | |
Other clones in our bank | human sox11 (NCBI Gene 6664) | |
Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR | 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. |
---|---|
Ordering | Please visit Information of Request for Distribution. Order form [Credit Card Payment] [Bank Transfer or Check Payment] Material Transfer Agreement (MTA) [Word] |
Catalog # | Resource name | Shipping form | Fee (non-profit org.) |
---|---|---|---|
RDB06758 | pGEM3Zf_hsSox11 | DNA solution |
Electronic file
Featured content
References
User reports and related articles (go to bottom)
This clone will be sequenced a portion and digested by restriction enzyme for examination.
References
2018.11.21
GNP_filter3_RDBDEP_html_181012.pl