Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pGEM3Zf_hsBrachyury

Plasmid vector of human brachyury.

Catalog number RDB06756
Resource name pGEM3Zf_hsBrachyury
Alternative name SET-0227_69
Clone info. Plasmid vector of human brachyury.
PCR cloning, forward primer: atgagctcccctggcaccga; reverse primer: tcacatggaaggtggcgaca. Nucleotide insertion of CAG between 1223 and 1224 (243QWG to 243QSGG) to NM_003181.2.
Vector backbone pGEM-3Zf(+) (Plasmid)
Selectable markers Amp^r
Gene/insert name Human T, brachyury homolog cDNA
Depositor|Developer Nakamura, Yukio |
 
Other clones in our bank human T (NCBI Gene 6862) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB06756 pGEM3Zf_hsBrachyury Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content


Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


References

Original, user report and related articles


2020.02.22

GNP_filter3_RDBDEP_html_191130.pl