Resource data sheet
Prev.

pGEM3Zf_hsBrachyury

Plasmid vector of human Brachyury

Catalog number RDB06755
Resource name pGEM3Zf_hsBrachyury
Alternative name SET-0227_12
Clone info. Plasmid vector of human Brachyury.
F-primer: atgagctcccctggcaccga; R-primer: tcacatggaaggtggcgaca. Nucleotide substitution G1565A (V358I) to NM_003181.2.
Vector backbone pGEM-3Zf(+) (Plasmid)
Selectable markers Amp^r
Gene/insert name Human T, brachyury homolog cDNA
Depositor Nakamura, Yukio |
 
Other clones in our bank human T (NCBI Gene 6862) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06755 pGEM3Zf_hsBrachyury DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB12790_A4Em.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: M13_-40 RDB12790_A4Ema.seq
>06755_12790_A4Em_M13(-40)_A11_02.ab1
    1 AAGCGCGATT GTATACGACT CACTATAGGG CGAATTCGAG CTCGGTACCC GGGGATCCTC
   61 TAGAGTCTCA CATGGAAGGT GGCGACACAG GTGTCCATGA GGCTATGAGG CGGCCTTGGG
  121 CTGCGGCGTC GTACTGGCTG TCCACGATGT CTGTGGCCGC GGCCGCCCCT TCGTACAGTG
  181 GGGATCCCGA GGAAGAGGGC GCCGAGACCG GATGGGTGAG GGGTGTGTAG TGCGCGGGGG
  241 AGCCCCGGAA GAACTGGGCC CCCAGCCCGT TGGACACGGC TGCTGCCTGG GAGCCCGGGG
  301 TGATGGCGCC GTTGCTCACA GACCACAGGC TGGGGTACTG ACTGGAGCTG GTAGGTGGGC
  361 TGGCATTGTG GCTCACGGGG AGCATGCTGG GATGGGCAGG CATTCCAAGG CTGGACCAAT
  421 TGTCATGGGA TTGCAGCATG GATAAACATG CAGGTGAGTT GTCAGAATAG GTTGGAGAAT
  481 TGTTCCGATG AGCATAGGGG CTGGGGTAGG GTGAGGACCG GTGGCTCCTC AGGGTTGGGT
  541 ACCTGTCACA GCTGTGCGTG GAGGGGAGGG AGAGGGCACC TCCAAACTGA GGATGAGGAT
  601 TTGCAGGTGG ACACAGGGTG CTGGTTCCAG GAAGAAGCCA CCCCCATTGG GAGTACCCAG
  661 GTTGCTGGCT GTCTCCGGGT TCCTCCATCA TCTCTTTGTG ATCACTTCTT TCCTTTGCAT
  721 CAAGGAAAGC TTTTGCAAAT GGATTGTACT TAATTTTAAG AGCTGTGATC TCCTCGTTCT
  781 GATAAGCAGT CACCGCTATG AACTGGGTCT CAGGGAAGCA GTGGCTGGTG ATCATGCGCT
  841 GTGGACCCCC AACTCTCACT ATGTGGATTC GAGGCTCATA CTTATGCAAG GAGTTCAGCA
  901 TGATCTGGCC CCCTCCGTTG AGCTTGTTGG TGAGCTTGAC TTTGCTGAAG GAGACGGGAG
  961 CCTTCATCCA GTGGGCCCCG AAGTTTGGGC GAGTCGGGGT GGATGTAGAC GCAGCTGGGC
 1021 GCCCTGCGGC TCCGGCTTGC CCCCCCGGCA CCCATTTCCC CGTTTCACGT ACTTTCCAGC
 1081 GATGGATGGT TCCGCCGGCC ACCGGAAGTC AGCCAGAGAA GTACATGGCG TTTGGGGATC
1141 AGGCCCAGAA CCACGGTTTC AACT
//
Primer: Reverse2 RDB12790_A4Emb.seq
>06755_12790_A4Em_Reverse2_B11_05.ab1
    1 AATACATGAA TTACGCCAGC TATTTAGGTG ACACTATAGA ATACTCAAGC TTGCATGCCT
   61 GCAGGTCATG AGCTCCCCTG GCACCGAGAG CGCGGGAAAG AGCCTGCAGT ACCGAGTGGA
  121 CCACCTGCTG AGCGCCGTGG AGAATGAGCT GCAGGCGGGC AGCGAGAAGG GCGACCCCAC
  181 AGAGCGCGAA CTGCGCGTGG GCCTGGAGGA GAGCGAGCTG TGGCTGCGCT TCAAGGAGCT
  241 CACCAATGAG ATGATCGTGA CCAAGAACGG CAGGAGGATG TTTCCGGTGC TGAAGGTGAA
  301 CGTGTCTGGC CTGGACCCCA ACGCCATGTA CTCCTTCCTG CTGGACTTCG TGGCGGCGGA
  361 CAACCACCGC TGGAAGTACG TGAACGGGGA ATGGGTGCCG GGGGGCAAGC CGGAGCCGCA
  421 GGCGCCCAGC TGCGTCTACA TCCACCCCGA CTCGCCCAAC TTCGGGGCCC ACTGGATGAA
  481 GGCTCCCGTC TCCTTCAGCA AAGTCAAGCT CACCAACAAG CTCAACGGAG GGGGCCAGAT
  541 CATGCTGAAC TCCTTGCATA AGTATGAGCC TCGAATCCAC ATAGTGAGAG TTGGGGGTCC
  601 ACAGCGCATG ATCACCAGCC ACTGCTTCCC TGAGACCCAG TTCATAGCGG TGACTGCTTA
  661 TCAGAACGAG GAGATCACAG CTCTTAAAAT TAAGTACAAT CCATTTGCAA AAGCTTTCCT
  721 TGATGCAAAG GAAAGAAGTG ATCACAAAGA GATGATGGAG GAACCCGGAG ACAGCCAGCA
  781 ACCTGGGTAC TCCCAATGGG GGTGGCTTCT TCCTGGAACC AGCACCCTGT GTCCACCTGC
  841 AAATCCTCAT CCTCAGTTTG GAGGTGCCCT CTCCCTCCCC TCCACGCACA GCTGTGACAG
  901 GTACCCAACC CTGAGGAGCC ACCGGTCCTC ACCCTACCCC AGCCCCTATG CTCATCGGAA
  961 CAATTCTCCA ACCTATTCTG ACAACTCACC TGCATGTTAT CCATGCTGCA ATCCCATGAC
 1021 AATTGGTCCA GCCTTGGTAA TGCCTGCCCA TCCCAGCATG CTCCCCGTGA GCCACAATGC
 1081 CAGCCACTAC AGCTCCAGTC AGTAACCCCA GCTGTGATCT GTGAGCACCG ACGGCAATCA
1141 CCCCCGGGAC CTCCCAGGCC AGGCC
//

Please visit Sequencing and PCR primers for primer information.


References

References


2018.11.21

GNP_filter3_RDBDEP_html_181012.pl