Resource data sheet


Expression vector of human GATA1

Catalog number RDB06753
Resource name pCMFlag_hsGATA1
Alternative name SET-0120_1
Clone info. Expression vector of human GATA1. Expression was confirmed by Western blotting with anti-FLAG antibody.
F-primer: gagttccctggcctggggtc; R-primer: tcatgagctgagcggagccac.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human GATA1 cDNA
Depositor DNA Bank, |
Other clones in our bank human GATA1 (NCBI Gene 2623) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Ordering Information [in Japanese] [in English]
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
(Japanese text [open/close])

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06753 pCMFlag_hsGATA1 DNA solution

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB13039_A6Cep1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward RDB13039_A6Cea.seq
Primer: BGH_rev RDB13039_A6Ceb.seq
Primer: SV40pro_F_V2 RDB13039_A6Cec.seq

Please visit plasmidSequencing and PCR primers for primer information.

References and tips

Electronic file

Electronic file PDF RDB06753.pdf from Depositor

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)


user report Nishino, T., Antagonizing effect of CLPABP on the function of HuR as a regulator of ARE-containing leptin mRNA stability and the effect of its depletion on obesity in old male mouse. Biochim. Biophys. Acta. 2016 Sep 9. pii: S1388-1981(16)30243-8. doi: 10.1016/j.bbalip.2016.09.006. [Epub ahead of print] PMID 27616329.
