Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pCMFlag_hsGDF3

Expression vector of human GDF3.

Catalog number RDB06722
Resource name pCMFlag_hsGDF3
Alternative name SET-0230_18
Clone info. Expression vector of human GDF3. Expression was confirmed by Western blotting with anti-FLAG antibody.
PCR cloning, forward primer: atgcttcgtttcttgccaga; reverse primer: ctacccacacccacattcat.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human growth differentiation factor 3 cDNA
Depositor|Developer DNA Bank, |
 
Other clones in our bank human GDF3 (NCBI Gene 9573) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB06722 pCMFlag_hsGDF3 Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content


Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


References

Original, user report and related articles


2020.02.22

GNP_filter3_RDBDEP_html_191130.pl