Resource data sheet
Prev.

pGEM3Zf_hsSox2(F)

Plasmid vector of human SOX2 cDNA

Catalog number RDB06688
Resource name pGEM3Zf_hsSox2(F)
Alternative name SET-0313_14
Clone info. Plasmid vector of human SOX2 cDNA.
This clone is the same as SET0215, but used different backbones khES-1. F-primer: atgtacaacatgatggagacgga; R-primer: tcacatgtgtgagaggggcagt. iPS Yamanaka factor.
Vector backbone pGEM-3Zf(+) (Plasmid)
Selectable markers Amp^r
Gene/insert name Human Sox2 cDNA
Depositor Nakamura, Yukio |
 
Other clones in our bank human SOX2 (NCBI Gene 6657) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06688 pGEM3Zf_hsSox2(F) DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References


2018.11.21

GNP_filter3_RDBDEP_html_181012.pl