Resource data sheet
Prev.

pGEM3Zf_hsRex1

Plasmid clone of human REX1 cDNA

Catalog number RDB06675
Resource name pGEM3Zf_hsRex1
Alternative name SET-0231_38
Clone info. Plasmid clone of human REX1 cDNA.
F-primer: atgagccagcaactgaagaa; R-primer: ctgttggaggactactttccct.
Vector backbone pGEM-3Zf(+) (Plasmid)
Selectable markers Amp^r
Gene/insert name Human zinc finger protein 42 homolog (mouse) cDNA
Depositor Nakamura, Yukio |
 
Other clones in our bank human ZFP42 (NCBI Gene 132625) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06675 pGEM3Zf_hsRex1 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References


2018.11.21

GNP_filter3_RDBDEP_html_181012.pl