Resource data sheet
Prev.

pGEM3Zf_hsL-Myctv1

Plasmid clone of human L-Myc cDNA

Catalog number RDB06674
Resource name pGEM3Zf_hsL-Myctv1
Alternative name SET-0249_2
Clone info. Plasmid clone of human L-Myc cDNA.
F-primer: gactacgactcgtaccagcact; R-primer: ttagtagccagtgaggtatgcaa. Nucleotide substitution C1670A (G363G) to NM_001033081. iPS Yamanaka factor.
Vector backbone pGEM-3Zf(+) (Plasmid)
Selectable markers Amp^r
Gene/insert name Human v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) transcript variant 1 cDNA
Depositor Nakamura, Yukio |
 
Other clones in our bank human L-Myc, MYCL (NCBI Gene 4610) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06674 pGEM3Zf_hsL-Myctv1 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB13527_A5Ipp1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: M13_-40 RDB13527_A5Ipa.seq
>06674_13527_A5Ip_M13(-40)_H02_23.ab1
    1 AGGCAATTAA TTGTATACGA CTCACTATAG GGCGAATTCG AGCTCGGTAC CCGGGGATCC
   61 TCTAGAGTCG ACTACGACTC GTACCAGCAC TATTTCTACG ACTATGACTG CGGGGAGGAT
  121 TTCTACCGCT CCACGGCGCC CAGCGAGGAC ATCTGGAAGA AATTCGAGCT GGTGCCATCG
  181 CCCCCCACGT CGCCGCCCTG GGGCTTGGGT CCCGGCGCAG GGGACCCGGC CCCCGGGATT
  241 GGTCCCCCGG AGCCGTGGCC CGGAGGGTGC ACCGGAGACG AAGCGGAATC CCGGGGCCAC
  301 TCGAAAGGCT GGGGCAGGAA CTACGCCTCC ATCATACGCC GTGACTGCAT GTGGAGCGGC
  361 TTCTCGGCCC GGGAACGGCT GGAGAGAGCT GTGAGCGACC GGCTCGCTCC TGGCGCGCCC
  421 CGGGGGAACC CGCCCAAGGC GTCCGCCGCC CCGGACTGCA CTCCCAGCCT CGAAGCCGGC
  481 AACCCGGCGC CCGCCGCCCC CTGTCCGCTG GGCGAACCCA AGACCCAGGC CTGCTCCGGG
  541 TCCGAGAGCC CAAGCGACTC GGAGAATGAA GAAATTGATG TTGTGACAGT AGAGAAGAGG
  601 CAGTCTCTGG GTATTCGGAA GCCGGTCACC ATCACGGTGC GAGCAGACCC CCTGGATCCC
  661 TGCATGAAGC ATTTCCACAT CTCCATCCAT CAGCAACAGC ACAACTATGC TGCCCGTTTT
  721 CCTCCAGAAA GCTGCTCCCA AGAAGAGGCT TCAGAGAGGG GTCCCCAAGA AGAGGTTCTG
  781 GAGAGAGATG CTGCAGGGGA AAAGGAAGAT GAGGAGGATG AAGAGATTGT GAGTCCCCCA
  841 CCTGTAGAAA GTGAGGCTGC CCAGTCCTGC CACCCCAAAC CTGTCAGTTC TGATACTGAG
  901 GATGTGACCA AGAGGAAGAA TCACAACTTC CTGGAGCGCA AGAGGCGGAA TGACCTGCGT
  961 TCGCGATTCT TGGCGCTGAG GGACCAGGTG CCCACCCTGG CCCAGCTGCT CCAAGGCCCC
 1021 AAGTAGTGAT CCCTAAGCAA AGGCCCTTGG AATACTTTGC AAGCCCTGAT GGGGGGCTGA
 1081 GAGAGGATGG CCTACAGAGA AAAGACAGCT TCGAATGCTG GCAGGCCAGC CAGGTTGGCC
1141 AGAAAAAGAA ATTGCCAATT ACTCTCCAAC CCTGTGTC
//
Primer: Reverse2 RDB13527_A5Ipb.seq
>06674_13527_A5Ip_Reverse2_A03_03.ab1
    1 AATACAGATT ACGCCAGCTA TTTAGGTGAC ACTATAGAAT ACTCAAGCTT GCATGCCTGC
   61 AGGTCTTAGT AGCCAGTGAG GTATGCAATT CTTTTCTGCA ACTGCTGCTG CCGGCATCGG
  121 AGCTGTCTTT TCTCTGTAGC CATCCTCTTC TCAGCCCCCA CCAGGGCTTG CAAGTATTCC
  181 AAGGCCTTGC TTAGGATCAC TACTTTGGGG GCCTTGGAGC AGCTGGCCAG GGTGGGCACC
  241 TGGTCCCTCA GCGCCAAGAA TCGCGAACGC AGGTCATTCC GCCTCTTGCG CTCCAGGAAG
  301 TTGTGATTCT TCCTCTTGGT CACATCCTCA GTATCAGAAC TGACAGGTTT GGGGTGGCAG
  361 GACTGGGCAG CCTCACTTTC TACAGGTGGG GGACTCACAA TCTCTTCATC CTCCTCATCT
  421 TCCTTTTCCC CTGCAGCATC TCTCTCCAGA ACCTCTTCTT GGGGACCCCT CTCTGAAGCC
  481 TCTTCTTGGG AGCAGCTTTC TGGAGGAAAA CGGGCAGCAT AGTTGTGCTG TTGCTGATGG
  541 ATGGAGATGT GGAAATGCTT CATGCAGGGA TCCAGGGGGT CTGCTCGCAC CGTGATGGTG
  601 ACCGGCTTCC GAATACCCAG AGACTGCCTC TTCTCTACTG TCACAACATC AATTTCTTCA
  661 TTCTCCGAGT CGCTTGGGCT CTCGGACCCG GAGCAGGCCT GGGTCTTGGG TTCGCCCAGC
  721 GGACAGGGGG CGGCGGGCGC CGGGTTGCCG GCTTCGAGGC TGGGAGTGCA GTCCGGGGCG
  781 GCGGACGCCT TGGGCGGGTT CCCCCGGGGC GCGCCAGGAG CGAGCCGGTC GCTCACAGCT
  841 CTCTCCAGCC GTTCCCGGGC CGAGAAGCCG CTCCACATGC AGTCACGGCG TATGATGGAG
  901 GCGTAGTTCC TGCCCCAGCC TTTCGAGTGG CCCCGGGATT CCGCTTCGTC TCCGGTGCAC
  961 CCTCCGGGCC ACGGCTCCGG GGGACCAATC CCGGGGGCCG GGTCCCCTGC GCCGGGACCC
 1021 AGCCCCAGGC GCGACGTGGG GGGGCGATGC ACCAGCTCGA TTCTTCCAGA TGTCTCGCTG
 1081 GGCGCCGTTG AAGCGTTAGA ATCTCCCGCA GTCATAGTCG TAGAAATAGT GCTTGCTTAC
1141 GAGTCGGTTA GTCCGAACT
//

Please visit Sequencing and PCR primers for primer information.


References

References


2018.12.11

GNP_filter3_RDBDEP_html_181012.pl