Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pCMFlag_hsIL1B

Expression vector of human IL1B/IL-1 beta.

Catalog number RDB06666
Resource name pCMFlag_hsIL1B
Alternative name SET-0196_11
Clone info. Expression vector of human IL1B/IL-1 beta. Expression was confirmed by Western blotting with anti-FLAG antibody.
Derived from Sugano CAS08366. PCR cloning, forward primer: gcagaagtacctgagctcgccag; reverse primer: ctttaggaagacacaaattgcatgg. Nucleotide substitution T673C (silent) to NM_000576.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human IL1B/IL-1 beta cDNA
Depositor|Developer DNA Bank, |
 
Other clones in our bank human IL1B (NCBI Gene 3553) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06666 pCMFlag_hsIL1B DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB06666.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB13520_A5Iop1.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward
Sequence file: RDB13520_A5Ioa.seq check
>06666_13520_A5Io_CMV-Forward_D12_12.ab1
    1 TTTACACTCC GCCCATTGAC GCAATGGGCG GTAGGCGTGT ACGGTGGGAG GTCTATATAA
   61 GCAGAGCTCT CTGGCTAACT AGAGAACCCA CTGCTTACTG GCTTATCGAA ATTAATACGA
  121 CTCACTATAG GGAGACCCAA GCTGAATTCA CCATGGACTA CAAGGACGAT GACGATAAGG
  181 CGGCCGCAGA AGTACCTGAG CTCGCCAGTG AAATGATGGC TTATTACAGT GGCAATGAGG
  241 ATGACTTGTT CTTTGAAGCT GATGGCCCTA AACAGATGAA GTGCTCCTTC CAGGACCTGG
  301 ACCTCTGCCC TCTGGATGGC GGCATCCAGC TACGAATCTC CGACCACCAC TACAGCAAGG
  361 GCTTCAGGCA GGCCGCGTCA GTTGTTGTGG CCATGGACAA GCTGAGGAAG ATGCTGGTTC
  421 CCTGCCCACA GACCTTCCAG GAGAATGACC TGAGCACCTT CTTTCCCTTC ATCTTTGAAG
  481 AAGAACCTAT CTTCTTCGAC ACATGGGATA ACGAGGCTTA TGTGCACGAT GCACCTGTAC
  541 GATCACTGAA CTGCACGCTC CGGGACTCAC AGCAAAAAAG CTTGGTGATG TCTGGTCCAT
  601 ATGAACTGAA AGCTCTCCAC CTCCAGGGAC AGGATATGGA GCAACAAGTG GTGTTCTCCA
  661 TGTCCTTTGT ACAAGGAGAA GAAAGTAATG ACAAAATACC TGTGGCCTTG GGCCTCAAGG
  721 AAAAGAATCT GTACCTGTCC TGCGTGTTGA AAGATGATAA GCCCACCCTA CAGCTGGAGA
  781 GTGTAGATCC CAAAAATTAC CCAAAGAAGA GATGGAAAAG CGATTTGTCT TCAACAGATA
  841 GAAATCAATA ACAAGCTGGA ATTTGAGTCT GCCCAGTTCC CCAACTGGTA CATCAGCACT
  901 CTCAGCAGAA ACATGCCCGT CTTCTGGAGG ACAAGCGCAG ATATACTGAC TCACATGCAT
  961 TTGTGTCTCT AAAGCCGCTC GAGCATGCAT CTAGAGACTA TTCTATATGT CACTTAATGC
 1021 TAAGCTCGCT GATCAGCTCG ACTGTGCTTC AGTGCCAGCA ATCGTGAGGC AGCGTGCATC
1081 TGACTGAAGT CAGCCAACTG TCGTC
//
Primer: BGH_rev
Sequence file: RDB13520_A5Iob.seq check
>06666_13520_A5Io_BGHrev_E07_13.ab1
    1 GATTGGCATA GGGTGACTAT AGAATAGGGC CCTCTAGATG CATGCTCGAG CGGCCCTTTA
   61 GGAAGACACA AATTGCATGG TGAAGTCAGT TATATCCTGG CCGCCTTTGG TCCCTCCCAG
  121 GAAGACGGGC ATGTTTTCTG CTTGAGAGGT GCTGATGTAC CAGTTGGGGA ACTGGGCAGA
  181 CTCAAATTCC AGCTTGTTAT TGATTTCTAT CTTGTTGAAG ACAAATCGCT TTTCCATCTT
  241 CTTCTTTGGG TAATTTTTGG GATCTACACT CTCCAGCTGT AGGGTGGGCT TATCATCTTT
  301 CAACACGCAG GACAGGTACA GATTCTTTTC CTTGAGGCCC AAGGCCACAG GTATTTTGTC
  361 ATTACTTTCT TCTCCTTGTA CAAAGGACAT GGAGAACACC ACTTGTTGCT CCATATCCTG
  421 TCCCTGGAGG TGGAGAGCTT TCAGTTCATA TGGACCAGAC ATCACCAAGC TTTTTTGCTG
  481 TGAGTCCCGG AGCGTGCAGT TCAGTGATCG TACAGGTGCA TCGTGCACAT AAGCCTCGTT
  541 ATCCCATGTG TCGAAGAAGA TAGGTTCTTC TTCAAAGATG AAGGGAAAGA AGGTGCTCAG
  601 GTCATTCTCC TGGAAGGTCT GTGGGCAGGG AACCAGCATC TTCCTCAGCT TGTCCATGGC
  661 CACAACAACT GACGCGGCCT GCCTGAAGCC CTTGCTGTAG TGGTGGTCGG AGATTCGTAG
  721 CTGGATGCCG CCATCCAGAG GGCAGAGGTC CAGGTCCTGG AAGGAGCACT TCATCTGTTT
  781 AGGGCCATCA GCTTCAAAGA ACAAGTCATC CTCATTGCCA CTGTAATAAG CCATCATTTC
  841 ACTGGCGAGC TCAGGTACTT CTGCGGCCGC CTTATCGTCA TCGTCCTTGT AGTCCATGGT
  901 GAATTCAGCT TGGGTCTCCC TATAGTGAGT CGTATTAATT TCGATAAGCC AGTAAGCAGT
  961 GGGTTTCTCT AGTTTAGCCA GAGAGCTCTG CTTATATAGA CCCTCCCACC CGTACACGCC
 1021 CTACGGCCCA TTTGGCGTCA ATGGGCCGAA GTGGTTACGA CATTTTGCAA GTCCGATTGA
1081 ATTTTTGGCT GACCGACAAC AAAACGT
//
Primer: SV40pro_F_V2
Sequence file: RDB13520_A5Ioc.seq check
>06666_13520_A5Io_SV40pro_F_V2_F12_18.ab1
    1 GTCCGAACTT TTTTTGGAGC TAGGCTTTTG CAAAAGCTCC CGGGAGCTTG GATATCCATT
   61 TTCGGATCTG ATCAAGAGAC AGGATGAGGA TCGTTTCGCA TGATTGAACA AGATGGATTG
  121 CACGCAGGTT CTCCGGCCGC TTGGGTGGAG AGGCTATTCG GCTATGACTG GGCACAACAG
  181 ACAATCGGCT GCTCTGATGC CGCCGTGTTC CGGCTGTCAG CGCAGGGGCG CCCGGTTCTT
  241 TTTGTCAAGA CCGACCTGTC CGGTGCCCTG AATGAACTGC AGGACGAGGC AGCGCGGCTA
  301 TCGTGGCTGG CCACGACGGG CGTTCCTTGC GCAGCTGTGC TCGACGTTGT CACTGAAGCG
  361 GGAAGGGACT GGCTGCTATT GGGCGAAGTG CCGGGGCAGG ATCTCCTGTC ATCTCACCTT
  421 GCTCCTGCCG AGAAAGTATC CATCATGGCT GATGCAATGC GGCGGCTGCA TACGCTTGAT
  481 CCGGCTACCT GCCCATTCGA CCACCAAGCG AAACATCGCA TCGAGCGAGC ACGTACTCGG
  541 ATGGAAGCCG GTCTTGTCGA TCAGGATGAT CTGGACGAAG AGCATCAGGG GCTCGCGCCA
  601 GCCGAACTGT TCGCCAGGCT CAAGGCGCGC ATGCCCGACG GCGAGGATCT CGTCGTGACC
  661 CATGGCGATG CCTGCTTGCC GAATATCATG GTGGAAAATG GCCGCTTTTC TGGATTCATC
  721 GACTGTGGCC GGCTGGGTGT GGCGGACCGC TATCAGGACA TAGCGTTGGC TACCCGTGAT
  781 ATTGCTGAAG AGCTTGGCGG CGAATGGGCT GACCGCTTCC TCGTGCTTTA CGGTATCGCC
  841 GCTCCCGATT CGCAGCGCAT CGCCTTCTAT CGCCTTCTTG ACGAGTTCTT CTGAGCGGGA
  901 CTCTGGGGTT CGAAATGACC GACCAAGCGA CGCCCAACCT GCCATCACGA GATTTCGATT
  961 CCACCGCCGC CTTCTATGAA AAGTTTGGGC TTCGGAATCG TTTTCCGGGA CGCCGGCTGG
 1021 ATGATCTCAG CGCGGGGATC TCATGCTGGA GTCTCGCCCA CCCCAAAGTG TTATGCAGCT
 1081 TATATGTACA AATAAGGCAA TAGCATCACA TTCACAAATT AAGCATTTTT CACTGACATT
1141 TCTAGGATTG TTTG
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles

user report Yokoyama, C., Interleukin-8 enhances the effect of colchicine on cell death. Biochem. Biophys. Res. Commun. 485 (1): 89-94 (2017). PMID 28189686.
user report Suzuki, S., Shigella type III secretion protein MxiI is recognized by Naip2 to induce Nlrc4 inflammasome activation independently of Pkc delta. PLoS Pathog., 10 (2): e1003926 (2014). PMID 24516390.

2020.02.22

GNP_filter3_RDBDEP_html_191130.pl