Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pCMFlag_hsLIN28

Expression vector of human LIN28.

Catalog number RDB06602
Resource name pCMFlag_hsLIN28
Alternative name SET-0226_1
Clone info. Expression vector of human LIN28. Expression was confirmed by Western blotting with anti-FLAG antibody.
PCR cloning, forward primer: ggctccgtgtccaaccagcagtt; reverse primer: tcaattctgtgcctccgggagca.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human LIN28 cDNA
Depositor|Developer DNA Bank, |
 
Other clones in our bank human LIN28 (NCBI Gene 79727) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB06602 pCMFlag_hsLIN28 Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB06602.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)
Featured content Dnaconda's recommendation EXR0039e (English text)
Featured content Dnaconda's recommendation EXR0039j (Japanese text)

Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


References

Original, user report and related articles

user report Hayashi, S., Lin28a is a putative factor in regulating cancer stem cell-like properties in side population cells of oral squamous cell carcinoma. Exp Cell Res. 2013 May 1;319(8):1220-8. PMID 23500413.

2020.10.02

GNP_filter3_RDBDEP_html_200316.pl