Resource data sheet
Prev.

pCMFlag_hsLIN28

Expression vector of human LIN28

Catalog number RDB06602
Resource name pCMFlag_hsLIN28
Alternative name SET-0226_1
Clone info. Expression vector of human LIN28. Expression was confirmed by Western blotting with anti-FLAG antibody.
F-primer: ggctccgtgtccaaccagcagtt; R-primer: tcaattctgtgcctccgggagca iPS Yamanaka factor.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human LIN28 cDNA
Depositor DNA Bank, |
 
Other clones in our bank human LIN28 (NCBI Gene 79727) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06602 pCMFlag_hsLIN28 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB06602.pdf from Depositor

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)
Featured content Dnaconda's recommendation EXR0039e (English text)
Featured content Dnaconda's recommendation EXR0039j (Japanese text)

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References

user report Hayashi, S., Lin28a is a putative factor in regulating cancer stem cell-like properties in side population cells of oral squamous cell carcinoma. Exp Cell Res. 2013 May 1;319(8):1220-8. PMID 23500413.

2019.03.08

GNP_filter3_RDBDEP_html_190307.pl