Resource data sheet
Prev.

pGEM3Zf_hsLIN28

Plasmid clone of human LIN28 cDNA

Catalog number RDB06427
Resource name pGEM3Zf_hsLIN28
Alternative name SET-0225_8
Clone info. Plasmid clone of human LIN28 cDNA.
F-primer: ggctccgtgtccaaccagcagtt; R-primer: tcaattctgtgcctccgggagca iPS Yamanaka factor.
Vector backbone pGEM-3Zf(+) (Plasmid)
Size of vector backbone 3,197 bp
Selectable markers Amp^r
Gene/insert name Human LIN28 cDNA
Depositor Nakamura, Yukio |
 
Other clones in our bank human LIN28 (NCBI Gene 79727) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06427 pGEM3Zf_hsLIN28 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB13526_A5Ipp1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: M13_-40 RDB13526_A5Ipa.seq
>06427_13526_A5Ip_M13(-40)_C06_09.ab1
    1 AAGGCGGGAA TGTATACGAC TCACTATAGG GCGAATTCGA GCTCGGTACC CGGGGATCCT
   61 CTAGAGTCGG CTCCGTGTCC AACCAGCAGT TTGCAGGTGG CTGCGCCAAG GCGGCAGAAG
  121 AGGCGCCCGA GGAGGCGCCG GAGGACGCGG CCCGGGCGGC GGACGAGCCT CAGCTGCTGC
  181 ACGGTGCGGG CATCTGTAAG TGGTTCAACG TGCGCATGGG GTTCGGCTTC CTGTCCATGA
  241 CCGCCCGCGC CGGGGTCGCG CTCGACCCCC CAGTGGATGT CTTTGTGCAC CAGAGTAAGC
  301 TGCACATGGA AGGGTTCCGG AGCTTGAAGG AGGGTGAGGC AGTGGAGTTC ACCTTTAAGA
  361 AGTCAGCCAA GGGTCTGGAA TCCATCCGTG TCACCGGACC TGGTGGAGTA TTCTGTATTG
  421 GGAGTGAGAG GCGGCCAAAA GGAAAGAGCA TGCAGAAGCG CAGATCAAAA GGAGACAGGT
  481 GCTACAACTG TGGAGGTCTA GATCATCATG CCAAGGAATG CAAGCTGCCA CCCCAGCCCA
  541 AGAAGTGCCA CTTCTGCCAG AGCATCAGCC ATATGGTAGC CTCATGTCCG CTGAAGGCCC
  601 AGCAGGGCCC TAGTGCACAG GGAAAGCCAA CCTACTTTCG AGAGGAAGAA GAAGAAATCC
  661 ACAGCCCTAC CCTGCTCCCG GAGGCACAGA ATTGAGACCT GCAGGCATGC AAAGCTTGAG
  721 TATTCTATAG TGTCACCTAA AATAGCTTGG CGTAATCATG GTCATAGCTG TTTCCTGTGT
  781 GAAATTGTTA TCCGCTCACA ATTCCACACA AACATACGAG CCGGGAAGCA TAAAGTGTAA
  841 AGCCTGGGGT GCCTAAATGA GTGAGCTAAC TCACATTAAA TTGCGTTGCG CTCACTGCCC
  901 GCTTTCCAGT CGGGAAAACC CTGTTCGTGC CAGCTGCATT AATGAATCGG GCCAAACGCG
961 CGGGAGGAGA AGCGGGTTTT GCGTATTTGG GCGGCTCT
//
Primer: Reverse2 RDB13526_A5Ipb.seq
>06427_13526_A5Ip_Reverse2_D06_12.ab1
    1 CAGGAAGGAA TTACGCCAGC TATTTAGGTG ACACTATAGA ATACTCAAGC TTGCATGCCT
   61 GCAGGTCTCA ATTCTGTGCC TCCGGGAGCA GGGTAGGGCT GTGGATTTCT TCTTCTTCCT
  121 CTCGAAAGTA GGTTGGCTTT CCCTGTGCAC TAGGGCCCTG CTGGGCCTTC AGCGGACATG
  181 AGGCTACCAT ATGGCTGATG CTCTGGCAGA AGTGGCACTT CTTGGGCTGG GGTGGCAGCT
  241 TGCATTCCTT GGCATGATGA TCTAGACCTC CACAGTTGTA GCACCTGTCT CCTTTTGATC
  301 TGCGCTTCTG CATGCTCTTT CCTTTTGGCC GCCTCTCACT CCCAATACAG AATACTCCAC
  361 CAGGTCCGGT GACACGGATG GATTCCAGAC CCTTGGCTGA CTTCTTAAAG GTGAACTCCA
  421 CTGCCTCACC CTCCTTCAAG CTCCGGAACC CTTCCATGTG CAGCTTACTC TGGTGCACAA
  481 AGACATCCAC TGGGGGGTCG AGCGCGACCC CGGCGCGGGC GGTCATGGAC AGGAAGCCGA
  541 ACCCCATGCG CACGTTGAAC CACTTACAGA TGCCCGCACC GTGCAGCAGC TGAGGCTCGT
  601 CCGCCGCCCG GGCCGCGTCC TCCGGCGCCT CCTCGGGCGC CTCTTCTGCC GCCTTGGCGC
  661 AGCCACCTGC AAACTGCTGG TTGGACACGG AGCCGACTCT AGAGGATCCC CGGGTACCGA
  721 GCTCGAATTC GCCCTATAGT GAGTCGTATT ACAATTCACT GGCCGTCGTT TTACAACGTC
  781 GTGACTGGGA AAACCCTGGC GTTACCCAAC TTAATCGCCT TGCAGCACAT CCCCCTTTCG
  841 CCAGCTGGCG TAATAGCGAA GAGGCCCGCA CCGATCGCCC TTCCCAACAG TTGCGCAGCC
  901 TGAATGGCGA ATGGACGCGC CCTGTAGCGG CGCATTAAGC GCGGCGGGTG TGGTGGTTAC
  961 GCGCAGCGTG ACCGCTACAC TTGCCAGCGC CCTAGCGCCC GCTCCTTTCG CTTTCTTCCC
 1021 TTTCCTTTCT CGCACGTTCG CCGGGCTTTC CCCGTCAAGC TCTAATCGGG GGCTCCCTTT
 1081 AGGTTCCGAT TAGTGCTTAC GGCACTCGAC CCGAAAAACT GGATTAGGTG AATGATTCAC
1141 GTTAGTGGGT CAATCGCCCC TGGAAATAGA AACCGGATTC
//

Please visit Sequencing and PCR primers for primer information.


References

References


2018.12.11

GNP_filter3_RDBDEP_html_181012.pl