Resource data sheet
Prev.

pGEM3Zf_hsNanog(R)

Plasmid clone of human Nanog cDNA

Catalog number RDB06426
Resource name pGEM3Zf_hsNanog(R)
Alternative name SET-0223_2
Clone info. Plasmid clone of human Nanog cDNA.
F-primer: atgagtgtggatccagcttgt; R-primer: tcacacgtcttcaggttgcat. Nucleotide substitution c1014t (silent) and t747c (silent) to NM_024865. iPS Yamanaka factor.
Vector backbone pGEM-3Zf(+) (Plasmid)
Size of vector backbone 3,197 bp
Selectable markers Amp^r
Gene/insert name Human Nanog cDNA
Depositor Nakamura, Yukio |
 
Other clones in our bank human NANOG (NCBI Gene 79923) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06426 pGEM3Zf_hsNanog(R) DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB13525_A5Ipp1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: M13_-40 RDB13525_A5Ipa.seq
>06426_13525_A5Ip_M13(-40)_A06_03.ab1
    1 AGGCAAGTTT AATTGGGTAT ACGAACTCAC TATAGGGCGG AAATTTCGAA GCCTCGGTAC
   61 CCGGGGGATC CTCTAGAGTC ATGAGTGTGG ATCCAGCTTG TCCCCAAAGC TTGCCTTGCT
  121 TTGAAGCATC CGACTGTAAA GAATCTTCAC CTATGCCTGT GATTTGTGGG CCTGAAGAAA
  181 ACTATCCATC CTTGCAAATG TCTTCTGCTG AGATGCCTCA CACGGAGACT GTCTCTCCTC
  241 TTCCTTCCTC CATGGATCTG CTTATTCAGG ACAGCCCTGA TTCTTCCACC AGTCCCAAAG
  301 GCAAACAACC CACTTCTGCA GAGAAGAGTG TCGCAAAAAA GGAAGACAAG GTCCCGGTCA
  361 AGAAACAGAA GACCAGAACT GTGTTCTCTT CCACCCAGCT GTGTGTACTC AATGATAGAT
  421 TTCAGAGACA GAAATACCTC AGCCTCCAGC AGATGCAAGA ACTCTCCAAC ATCCTGAACC
  481 TCAGCTACAA ACAGGTGAAG ACCTGGTTCC AGAACCAGAG AATGAAATCT AAGAGGTGGC
  541 AGAAAAACAA CTGGCCGAAG AATAGCAATG GTGTGACGCA GAAGGCCTCA GCACCTACCT
  601 ACCCCAGCCT CTACTCTTCC TACCACCAGG GATGCCTGGT GAACCCGACT GGGAACCTTC
  661 CAATGTGGAG CAACCAGACC TGGAACAATT CAACCTGGAG CAACGAGACC CAGAACATCC
  721 AAGTCCTGGA GCAACCACTC CTGGAACACT CAGACCTGGT GCACCCAATC CTGGAAACAA
  781 TCAGGCCTGG AAACAGTCCC TTCTATAAAC TGTGGAGGAG GAAATCTCTG CAGTCCTGCA
  841 TGCAGTTCCA GCCAAATTTC TCCTGCCAAT GACTTTGGAG GCTGCTTTTG GGAAGCTGCT
901 GGGGGAAGGC CTTAATGTAA TACA
//
Primer: Reverse2 RDB13525_A5Ipb.seq
>06426_13525_A5Ip_Reverse2_B06_06.ab1
    1 AAGACAGGAT TACGCCAGCT ATTTAGGTGA CACTATAGAA TACTCAAGCT TGCATGCCTG
   61 CAGGTCTCAC ACGTCTTCAG GTTGCATGTT CATGGAGTAG TTTAGGAATA AATCCATGGT
  121 TTGTGGAGTA CTAAAATACC TAGTGGTCTG CTGTATTACA TTAAGGCCTT CCCCAGCAGC
  181 TTCCAAAGCA GCCTCCAAGT CACTGGCAGG AGAATTTGGC TGGAACTGCA TGCAGGACTG
  241 CAGAGATTCC TCTCCACAGT TATAGAAGGG ACTGTTCCAG GCCTGATTGT TCCAGGATTG
  301 GGTGCACCAG GTCTGAGTGT TCCAGGAGTG GTTGCTCCAG GACTGGATGT TCTGGGTCTG
  361 GTTGCTCCAG GTTGAATTGT TCCAGGTCTG GTTGCTCCAC ATTGGAAGGT TCCCAGTCGG
  421 GTTCACCAGG CATCCCTGGT GGTAGGAAGA GTAGAGGCTG GGGTAGGTAG GTGCTGAGGC
  481 CTTCTGCGTC ACACCATTGC TATTCTTCGG CCAGTTGTTT TTCTGCCACC TCTTAGATTT
  541 CATTCTCTGG TTCTGGAACC AGGTCTTCAC CTGTTTGTAG CTGAGGTTCA GGATGTTGGA
  601 GAGTTCTTGC ATCTGCTGGA GGCTGAGGTA TTTCTGTCTC TGAAATCTAT CATTGAGTAC
  661 ACACAGCTGG GTGGAAGAGA ACACAGTTCT GGTCTTCTGT TTCTTGACCG GGACCTTGTC
  721 TTCCTTTTTT GCGACACTCT TCTCTGCAGA AGTGGGTTGT TTGCCTTTGG GACTGGTGGA
  781 AGAATCAGGG CTGTCCTGAA TAAGCAGATC CATGGAGGAA GGAAGAGGAG AGACAGTCTC
  841 CGTGTGAGGC ATCTCAGCAG AAGACATTTG CAAGGATGGA TAGTTTTCTT CAGGCCCACA
  901 AATCACAGGC ATAGGTGAAG ATTCTTTACA GTCGGATGCT TCAAAGCAAG GCAAGCTTTG
  961 GGGACAAGCT GGATCCACAC TCATGACTCT AGAGGATCCC CGGGTACCGA GCTCGAATTC
 1021 GCCCTATAGT GAGTCGTATT ACAATTCACT GGCCGTCGTT TTACAACGTC GTGACTGGGG
 1081 AAACCCTGCG TACCCCACTA ATCGCTTGCA GCACATTCCC CCTTCGCAGC TTGCCGTTAA
1141 TAGCGAAGAG GCCGCCACCG GAATTCGCCC TTCCCTAC
//

Please visit Sequencing and PCR primers for primer information.


References

References


2018.12.11

GNP_filter3_RDBDEP_html_181012.pl