Resource data sheet
Prev.

pGEM3Zf_hsNanog(F)

Plasmid clone of human Nanog cDNA

Catalog number RDB06425
Resource name pGEM3Zf_hsNanog(F)
Alternative name SET-0223_4
Clone info. Plasmid clone of human Nanog cDNA.
F-primer: atgagtgtggatccagcttgt; R-primer: tcacacgtcttcaggttgcat. iPS Yamanaka factor.
Vector backbone pGEM-3Zf(+) (Plasmid)
Size of vector backbone 3,197 bp
Selectable markers Amp^r
Gene/insert name Human Nanog cDNA
Depositor Nakamura, Yukio |
 
Other clones in our bank human NANOG (NCBI Gene 79923) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06425 pGEM3Zf_hsNanog(F) DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB12328_A3Kr.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: RDB12328_A3Kra.seq
>06425_12328_A3Kr_M13(-40)_A10_01.ab1
    1 ACGTCGCTAA TGTATACGAC TCACTATAGG GCGAATTCGA GCTCGGTACC CGGGGATCCT
   61 CTAGAGTCTC ACACGTCTTC AGGTTGCATG TTCATGGAGT AGTTTAGGAA TAAATCCATG
  121 GTTTGTGGAG TACTAAAATA CCTAGTGGTC TGCTGTATTA CATTAAGGCC TTCCCCAGCA
  181 GCTTCCAAGG CAGCCTCCAA GTCACTGGCA GGAGAATTTG GCTGGAACTG CATGCAGGAC
  241 TGCAGAGATT CCTCTCCACA GTTATAGAAG GGACTGTTCC AGGCCTGATT GTTCCAGGAT
  301 TGGGTGCACC AGGTCTGAGT GTTCCAGGAG TGGTTGCTCC AGGACTGGAT GTTCTGGGTC
  361 TGGTTGCTCC AGGTTGAATT GTTCCAGGTC TGGTTGCTCC ACATTGGAAG GTTCCCAGTC
  421 GGGTTCACCA GGCATCCCTG GTGGTAGGAA GAGTAAAGGC TGGGGTAGGT AGGTGCTGAG
  481 GCCTTCTGCG TCACACCATT GCTATTCTTC GGCCAGTTGT TTTTCTGCCA CCTCTTAGAT
  541 TTCATTCTCT GGTTCTGGAA CCAGGTCTTC ACCTGTTTGT AGCTGAGGTT CAGGATGTTG
  601 GAGAGTTCTT GCATCTGCTG GAGGCTGAGG TATTTCTGTC TCTGAAATCT ATCATTGAGT
661 ACACACAGCT GGGTGGAAGA GAACACAGTT CTGGTCTTCT
//
Primer: RDB12328_A3Krb.seq
>06425_12328_A3Kr_Reverse2_B10_04.ab1
    1 AAGTAAAAGG ATTCGCCAAG CTATTTAGGT GACACTATAG AATACTCAAG CTTGCATGCC
   61 TGCAGGTCAT GAGTGTGGAT CCAGCTTGTC CCCAAAGCTT GCCTTGCTTT GAAGCATCCG
  121 ACTGTAAAGA ATCTTCACCT ATGCCTGTGA TTTGTGGGCC TGAAGAAAAC TATCCATCCT
  181 TGCAAATGTC TTCTGCTGAG ATGCCTCACA CGGAGACTGT CTCTCCTCTT CCTTCCTCCA
  241 TGGATCTGCT TATTCAGGAC AGCCCTGATT CTTCCACCAG TCCCAAAGGC AAACAACCCA
  301 CTTCTGCAGA GAAGAGTGTC GCAAAAAAGG AAGACAAGGT CCCGGTCAAG AAACAGAAGA
  361 CCAGAACTGT GTTCTCTTCC ACCCAGCTGT GTGTACTCAA TGATAGATTT CAGAGACAGA
  421 AATACCTCAG CCTCCAGCAG ATGCAAGAAC TCTCCAACAT CCTGAACCTC AGCTACAAAC
  481 AGGTGAAGAC CTGGTTCCAG AACCAGAGAA TGAAATCTAA GAGGTGGCAG AAAAACAACT
  541 GGCCGAAGAA TAGCAATGGT GTGACGCAGA AGGCCTCAGC ACCTACCTAC CCCAGCCTTT
  601 ACTCTTCCTA CCACCAGGGA TGCCTGGTGA ACCCGACTGG GAACCTTCCA ATGTGGAGCA
661 ACCAGACCTG GAACAATTCA ACCTGGAGCA ACCAGACCCA
//

Please visit Sequencing and PCR primers for primer information.


References

References


2018.11.21

GNP_filter3_RDBDEP_html_181012.pl