Resource data sheet
Please review the QC test results indicated by check icon below as well as clone information before placing your order.


Expression vector of human AD4BP.

Catalog number RDB06299
Resource name pCMFlag_hsNR5A1
Alternative name SET-0097_13
Clone info. Expression vector of human AD4BP. Expression was confirmed by Western blotting with anti-FLAG antibody.
Derived from Sugano BC032501. PCR cloning, forward primer: gactattcgtacgacgagga; reverse primer: tcaagtctgcttggcttgca.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human SF-1; AD4BP cDNA
Depositor|Developer DNA Bank, |
Other clones in our bank human NR5A1 (NCBI Gene 2516) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer Payment]
Material Transfer Agreement (MTA for use for not-for-profit academic purpose) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06299 pCMFlag_hsNR5A1 DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Remarks, protocol and/or map (pdf) RDB06299.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)
Featured content Dnaconda's recommendation EXR0078j (Japanese text)
Featured content Dnaconda's recommendation EXR0078e (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB12861_A4Iqp1-2.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV_Forward
Region: CMV pro, T7 pro, FLAG, insert 5'
Sequence file: RDB12861_A4Iqd.seq check
1021 NNNN
Primer: BGH_rev2
Region: bGH p(A), SP6 pro, insert 3'
Sequence file: RDB12861_A4Iqe.seq check
Primer: SV40pro_ori_F
Region: SV40 pro_ori, NeoR
Sequence file: RDB12861_A4Iqf.seq check
1021 NNN

Please visit Sequencing and PCR primers for primer information.


Original, user report and related articles

user report Yamauchi, K., Overexpression of Nuclear Receptor 5A1 Induces and Maintains an Intermediate State of Conversion between Primed and Naive Pluripotency. Stem Cell Reports 14 (3): 506-519 (2020). PMID 32084386.
user report Matsuo, K., Significance of dopamine D1 receptor signalling for steroidogenic differentiation of human induced pluripotent stem cells. Sci. Rep. 7 (1): 15120 (2017). PMID 29123220.
user report Sonoyama, T.,, Differentiation of human embryonic stem cells and human induced pluripotent stem cells into steroid-producing cells. Endocrinology, 153 (9): 4336-4345 (2012). PMID 22778223.
