Resource data sheet


Expression vector of human AD4BP

Catalog number RDB06299
Resource name pCMFlag_hsNR5A1
Alternative name SET-0097_13
Clone info. Expression vector of human AD4BP. Expression was confirmed by Western blotting with anti-FLAG antibody.
Derived from Sugano BC032501. F-primer: gactattcgtacgacgagga; R-primer: tcaagtctgcttggcttgca.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human SF-1; AD4BP cDNA
Depositor DNA Bank, |
Other clones in our bank human NR5A1 (NCBI Gene 2516) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06299 pCMFlag_hsNR5A1 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB06299.pdf from Depositor

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)
Featured content Dnaconda's recommendation EXR0078j (Japanese text)
Featured content Dnaconda's recommendation EXR0078e (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB12861_A4Iq.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Foward | Sequence: RDB12861_A4Iqa.seq
Primer: BGH_rev | Sequence: RDB12861_A4Iqb.seq
1141 TCA

Please visit Sequencing and PCR primers for primer information.


Original, user report and related articles

user report Matsuo, K., Significance of dopamine D1 receptor signalling for steroidogenic differentiation of human induced pluripotent stem cells. Sci. Rep. 7 (1): 15120 (2017). PMID 29123220.
user report Sonoyama, T.,, Differentiation of human embryonic stem cells and human induced pluripotent stem cells into steroid-producing cells. Endocrinology, 153 (9): 4336-4345 (2012). PMID 22778223.
