Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pCMFlag_hsNR5A1

Expression vector of human AD4BP.

Catalog number RDB06299
Resource name pCMFlag_hsNR5A1
Alternative name SET-0097_13
Clone info. Expression vector of human AD4BP. Expression was confirmed by Western blotting with anti-FLAG antibody.
Derived from Sugano BC032501. PCR cloning, forward primer: gactattcgtacgacgagga; reverse primer: tcaagtctgcttggcttgca.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human SF-1; AD4BP cDNA
Depositor|Developer DNA Bank, |
 
Other clones in our bank human NR5A1 (NCBI Gene 2516) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06299 pCMFlag_hsNR5A1 DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB06299.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)
Featured content Dnaconda's recommendation EXR0078j (Japanese text)
Featured content Dnaconda's recommendation EXR0078e (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB12861_A4Iqp1-2.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV_Forward
Region: CMV pro, T7 pro, FLAG, insert 5'
Sequence file: RDB12861_A4Iqd.seq check
>06299_12861_A4Iq_CMV-Foward_A04_01.ab1
    1 NNNNNNNNNN NNNNNNNNNN NGNNNNNNNG GGCGGTAGGC GTGTACGGTG GGAGGTCTAT
   61 ATAAGCAGAG CTCTCTGGCT AACTAGAGAA CCCACTGCTT ACTGGCTTAT CGAAATTAAT
  121 ACGACTCACT ATAGGGAGAC CCAAGCTGAA TTCACCATGG ACTACAAGGA CGATGACGAT
  181 AAGGCGGCCG ACTATTCGTA CGACGAGGAC CTGGACGAGC TGTGCCCCGT GTGCGGGGAC
  241 AAGGTGTCCG GCTACCACTA CGGACTGCTC ACGTGTGAGA GCTGCAAGGG CTTCTTCAAG
  301 CGCACGGTGC AGAACAACAA GCACTACACG TGCACCGAGA GCCAGAGCTG CAAGATCGAC
  361 AAGACGCAGC GCAAGCGCTG TCCCTTCTGC CGCTTCCAGA AATGCCTGAC GGTGGGGATG
  421 CGCCTGGAAG CCGTGCGCGC TGACCGTATG AGGGGTGGCC GGAACAAGTT TGGGCCGATG
  481 TACAAGCGGG ACCGGGCCCT GAAACAGCAG AAGAAGGCAC AGATTCGGGC CAATGGCTTC
  541 AAGCTGGAGA CAGGGCCCCC GATGGGGGTG CCCCCGCCGC CCCCTCCCGC ACCGGACTAC
  601 GTGCTGCCTC CCAGCCTGCA TGGGCCTGAG CCCAAGGGCC TGGCCGCCGG TCCACCTGCT
  661 GGGCCACTGG GCGACTTTGG GGCCCCAGCA CTGCCCATGG CCGTGCCCGG TGCCCACGGG
  721 CCACTGGCTG GCTACCTCTA CCCTGCCTTT CCTGGCCGTG CCATCNAGTC TGANTACCCG
  781 GANCCTTATG CCAGCCCCCC ACAGCCTGGG CTGCCGTACN GCTACCCAGA GCCCTTCTCT
  841 GGANGGCCCN ACNNGCCTGA NCTCATCNTG CANCTGCTGC NGCTGGANCC NGATGANGAN
  901 CANGNNNGGG NCCGCATCTT GGGNTGCCNG NNNNANCCNN CCAAAAGCCG CCCCNANCAN
  961 NNNNNNGNNN TNNNNNNTNC TGNNNNNNAN NNNCNNANCN NANCNTTCNN NNNCNNNNNN
1021 NNNN
//
Primer: BGH_rev2
Region: bGH p(A), SP6 pro, insert 3'
Sequence file: RDB12861_A4Iqe.seq check
>06299_12861_B0CdS_BGH_rev2_D05_04_ABI08.ab1
    1 NNNNNNNNNN NNNNNNNNNG GNNGNNGGGN NAACAACAGA TGGCTGGCAA CTAGAAGGCA
   61 CAGTCGAGGC TGATCAGCGA GCTCTAGCAT TTAGGTGACA CTATAGAATA GGGCCCTCTA
  121 GATGCATGCT CGAGCGGCCT CAAGTCTGCT TGGCTTGCAG CATTTCGATG AGCAGGTTGT
  181 TGCGGGGCAT CTCGTTGCCC AGGTGCTTGT GGTACAGGTA CTCCTTGGCC TGCATGCTCA
  241 GGGCCCGCAC CTCCACCAGG CACAGCAGCA GCTGCTGGAA TTTGTCCCCG CAGTGCGGGT
  301 AGTGGCACAG GGTGTAGTCA AGCAGGGCGG CGTTGGCCTT CTCCTGAGCG TCTTTCACCA
  361 GGATGTGGTT ATTCAGGAAC TTCAAATCCA GGCTGAAGAG GATGATGAAC TTGAGGCAGA
  421 CAAACTCCTG CCGGTCCAGC TGCAGCGCAA GCAGCTGCAG CACCAGCTCC TGCGCCCGCA
  481 ACACCAGGCT GTGCAGCAGC GAGCCCGCCT GGGTGGCCAC TGTGGTCAGC TCCACCTCCT
  541 GCCCGGTGAC CAGCAGGATG CTGCCCTCCT TGCCGTGCTG GACCTGGCGG TAGATGTGGT
  601 CGAACACCAG CAGCTCGCTC CAGCAGTTCT GCAGCAGCGT CATCTGGTCG GCCACCTCCA
  661 GCTCCTTGAA GACCATGCAC CTGCGTGCCC AGTCCACGAT GGAGATGAAG GTCTGGTCGG
  721 CCATTCTGCA CAGGANGCCG AANGCCGCCG GCTGGTCGGG GCGGCTTTTG GTGGGCTCCT
  781 GCAGGCAGCC CAAGATGCGG GCCCGCACCT GGTCCTCATC CGGCTNCNGC TGCAGCAGCT
  841 GCANGANGAN CTCNNNCACG TNGGGCCCTC CAGANAANNG NNTCTGGGTA NCCNTACGGC
  901 AGCCCAGGCT GTGGGGGGCN NGNNTNANNN TNCNGGNANT CNNANTTGAT GGCNCNGNCC
961 NNNAAANNNN NGNNANNNNN NGNNNNNNNN NN
//
Primer: SV40pro_ori_F
Region: SV40 pro_ori, NeoR
Sequence file: RDB12861_A4Iqf.seq check
>06299_12861_B0CdS_SV40pro_ori_F_E05_05_ABI08.ab1
    1 NNNNNNNNNN NNNNNNNNNC NNCTCGNCCT CTGAGCTATT CNNGAAGTAG TGAGGAGGCT
   61 TTTTTGGAGG CCTAGGCTTT TGCAAAAAGC TCCCGGGAGC TTGGATATCC ATTTTCGGAT
  121 CTGATCAAGA GACAGGATGA GGATCGTTTC GCATGATTGA ACAAGATGGA TTGCACGCAG
  181 GTTCTCCGGC CGCTTGNGNG GAGAGGCTAT TCGGCTATGA CTGGGCACAA CAGACAATCG
  241 GCTGCTCTGA TGCCGCCGTG TTCCGGCTGT CAGCGCAGGG GCGCCCGGTT CTTTTTGTCA
  301 AGACCGACCT GTCCGGTGCC CTGAATGAAC TGCAGGACGA GGCAGCGCGG CTATCGTGGC
  361 TGGCCACGAC GGGCGTTCCT TGCGCAGCTG TGCTCGACGT TGTCACTGAA GCGGGAAGGG
  421 ACTGGCTGCT ATTGGGCGAA GTGCCGGGGC AGGATCTCCT GTCATCTCAC CTTGCTCCTG
  481 CCGAGAAAGT ATCCATCATG GCTGATGCAA TGCGGCGGCT GCATACGCTT GATCCGGCTA
  541 CCTGCCCATT CGACCACCAA GCGAAACATC GCATCGAGCG AGCACGTACT CGGATGGAAG
  601 CCGGTCTTGT CGATCAGGAT GATCTGGACG AAGAGCATCA GGGGCTCGCG CCAGCCGAAC
  661 TGTTCGCCAG GCTCAAGGCG CGCATGCCCG ACGGCGAGGA TCTCGTCGTG ACCCATGGCG
  721 ATGCCTGCTT GCCGAATATC ATGGTGGAAA ATGGCCGCTT TTCTGGATTC ATCGACTGTG
  781 GCCGGCTGGG TGTGGCGGAN CGCTATCNNA CATAGCGTTG GCTANCCGTG ATATTGCTGA
  841 AGANCTTGNN GGNNAANGGG CTNACCGCTT NCNCGTGCTT TACNGNATCG CCGCTCCCGA
  901 NTCNNANCGC ATCGCCNTCN NTCNNNTNCT TGANNANTTN TNNTGANCNG NNNTNTGGGG
  961 TTCNAAATGA NCGANCNAGC GNNNCCNNNN NTGNNNTCNN NNNNTTNNNA NNCNNNNNNN
1021 NNN
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles

user report Yamauchi, K., Overexpression of Nuclear Receptor 5A1 Induces and Maintains an Intermediate State of Conversion between Primed and Naive Pluripotency. Stem Cell Reports 14 (3): 506-519 (2020). PMID 32084386.
user report Matsuo, K., Significance of dopamine D1 receptor signalling for steroidogenic differentiation of human induced pluripotent stem cells. Sci. Rep. 7 (1): 15120 (2017). PMID 29123220.
user report Sonoyama, T.,, Differentiation of human embryonic stem cells and human induced pluripotent stem cells into steroid-producing cells. Endocrinology, 153 (9): 4336-4345 (2012). PMID 22778223.

2020.08.31

GNP_filter3_RDBDEP_html_200316.pl