Resource data sheet
Prev.

pCMFlag_hsNR5A1

Expression vector of human AD4BP

Catalog number RDB06299
Resource name pCMFlag_hsNR5A1
Alternative name SET-0097_13
Clone info. Expression vector of human AD4BP. Expression was confirmed by Western blotting with anti-FLAG antibody.
Derived from Sugano BC032501. F-primer: gactattcgtacgacgagga; R-primer: tcaagtctgcttggcttgca.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human SF-1; AD4BP cDNA
Depositor DNA Bank, |
 
Other clones in our bank human NR5A1 (NCBI Gene 2516) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL and cite Gene 200, 149-156, 1997 in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06299 pCMFlag_hsNR5A1 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB06299.pdf from Depositor

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB12861_A4Iq.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Foward RDB12861_A4Iqa.seq
>06299_12861_A4Iq_CMV-Foward_A04_01.ab1
    1 TTGTAACAAC TCCGCCCCAT TGACGCAATG GGCGGTAGGC GTGTACGGTG GGAGGTCTAT
   61 ATAAGCAGAG CTCTCTGGCT AACTAGAGAA CCCACTGCTT ACTGGCTTAT CGAAATTAAT
  121 ACGACTCACT ATAGGGAGAC CCAAGCTGAA TTCACCATGG ACTACAAGGA CGATGACGAT
  181 AAGGCGGCCG ACTATTCGTA CGACGAGGAC CTGGACGAGC TGTGCCCCGT GTGCGGGGAC
  241 AAGGTGTCCG GCTACCACTA CGGACTGCTC ACGTGTGAGA GCTGCAAGGG CTTCTTCAAG
  301 CGCACGGTGC AGAACAACAA GCACTACACG TGCACCGAGA GCCAGAGCTG CAAGATCGAC
  361 AAGACGCAGC GCAAGCGCTG TCCCTTCTGC CGCTTCCAGA AATGCCTGAC GGTGGGGATG
  421 CGCCTGGAAG CCGTGCGCGC TGACCGTATG AGGGGTGGCC GGAACAAGTT TGGGCCGATG
  481 TACAAGCGGG ACCGGGCCCT GAAACAGCAG AAGAAGGCAC AGATTCGGGC CAATGGCTTC
  541 AAGCTGGAGA CAGGGCCCCC GATGGGGGTG CCCCCGCCGC CCCCTCCCGC ACCGGACTAC
  601 GTGCTGCCTC CCAGCCTGCA TGGGCCTGAG CCCAAGGGCC TGGCCGCCGG TCCACCTGCT
  661 GGGCCACTGG GCGACTTTGG GGCCCCAGCA CTGCCCATGG CCGTGCCCGG TGCCCACGGG
  721 CCACTGGCTG GCTACCTCTA CCCTGCCTTT CCTGGCCGTG CCATCAAGTC TGAGTACCCG
  781 GAGCCTTATG CCAGCCCCCC ACAGCCTGGG CTGCCGTACG GCTACCCAGA GCCCTTCTCT
  841 GGAGGGCCCA ACGTGCCTGA GCTCATCCTG CAGCTGCTGC AGCTGGAGCC GGATGAGGAC
  901 CAGGTGCGGG CCCGCATCTT GGGCTGCCTG CAGGAGCCCA CCAAAAGCCG CCCCGACCAG
  961 CCGGCGGGCC TTCGGCCTCC TGTGCAGAAT GGCCCGACCA GACCCTTCAT CTCCATCGTG
 1021 GACTGGCACG CAGTGCATGG TCTTCAGAGC TGGAGTGGCC CGACCAGATG ACGCTGCTGC
 1081 AGAACTGCTG GAAGCGAGCC TGCCTGGATG ATCGGAACCA CATCTACCGC CAGGGCTTCC
1141 CAAGCCACCG
//
Primer: BGH_rev RDB12861_A4Iqb.seq
>06299_12861_A4Iq_BGH_rev_B04_04.ab1
    1 GCCCCTGTCA ATTTAGGTGA ACTATAGAAT AGGGCCCTCT AGATGCATGC TCGAGCGGCC
   61 TCAAGTCTGC TTGGCTTGCA GCATTTCGAT GAGCAGGTTG TTGCGGGGCA TCTCGTTGCC
  121 CAGGTGCTTG TGGTACAGGT ACTCCTTGGC CTGCATGCTC AGGGCCCGCA CCTCCACCAG
  181 GCACAGCAGC AGCTGCTGGA ATTTGTCCCC GCAGTGCGGG TAGTGGCACA GGGTGTAGTC
  241 AAGCAGGGCG GCGTTGGCCT TCTCCTGAGC GTCTTTCACC AGGATGTGGT TATTCAGGAA
  301 CTTCAAATCC AGGCTGAAGA GGATGATGAA CTTGAGGCAG ACAAACTCCT GCCGGTCCAG
  361 CTGCAGCGCA AGCAGCTGCA GCACCAGCTC CTGCGCCCGC AACACCAGGC TGTGCAGCAG
  421 CGAGCCCGCC TGGGTGGCCA CTGTGGTCAG CTCCACCTCC TGCCCGGTGA CCAGCAGGAT
  481 GCTGCCCTCC TTGCCGTGCT GGACCTGGCG GTAGATGTGG TCGAACACCA GCAGCTCGCT
  541 CCAGCAGTTC TGCAGCAGCG TCATCTGGTC GGCCACCTCC AGCTCCTTGA AGACCATGCA
  601 CCTGCGTGCC CAGTCCACGA TGGAGATGAA GGTCTGGTCG GCCATTCTGC ACAGGAGGCC
  661 GAAGGCCGCC GGCTGGTCGG GGCGGCTTTT GGTGGGCTCC TGCAGGCAGC CCAAGATGCG
  721 GGCCCGCACC TGGTCCTCAT CCGGCTCCAG CTGCAGCAGC TGCAGGATGA GCTCAGGCAC
  781 GTTGGGCCCT CCAGAGAAGG GCTCTGGGTA GCCGTACGGC AGCCCAGGCT GTGGGGGGCT
  841 GGCATAAGGC TCCGGGTACT CAGACTTGAT GGCACGGCCA GGAAAGGCAG GGTAGAGGTA
  901 GCCAGCCAGT GGCCCGTGGG CACCGGGCAC GGCCATGGGC AGTGCTGGGG CCCTTAAAGT
  961 CGCTCAGTGG CCTCAGCAGT GGACTCGGGC GGCTCAGGGC TCCTTGGGCT CAGCCTCATG
 1021 CAGCCTGGGA GGCAGCACGT AGTCCCGTGC GGAGGGGGCG GCGGGGGGCA CCTCTCATCG
 1081 GGGCCTGTCT TCCAGCTGAA GTATTGACCT GAATCTGTGC CCTTCTTTCT GTCCTGATTT
1141 TCA
//

Please visit Sequencing and PCR primers for primer information.


References

References

user report Matsuo, K., Significance of dopamine D1 receptor signalling for steroidogenic differentiation of human induced pluripotent stem cells. Sci. Rep. 7 (1): 15120 (2017). PMID 29123220.
user report Sonoyama, T.,, Differentiation of human embryonic stem cells and human induced pluripotent stem cells into steroid-producing cells. Endocrinology, 153 (9): 4336-4345 (2012). PMID 22778223.

2018.10.22

GNP_filter3_RDBDEP_html_181012.pl