Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pCMFlag_hsJUN

Expression vector of human JUN.

Catalog number RDB06254
Resource name pCMFlag_hsJUN
Alternative name SET-0010_37
Clone info. Expression vector of human JUN. Expression was confirmed by Western blotting with anti-FLAG antibody.
PCR cloning, forward primer: atgactgcaaagatggaaacg; reverse primer: tcaaaatgtttgcaactgctg.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human c-jun cDNA
Depositor|Developer DNA Bank, |
 
Other clones in our bank human JUN (NCBI Gene 3725) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA for use for not-for-profit academic purpose) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06254 pCMFlag_hsJUN DNA solution

Ordering Information [in Japanese] [in English]
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

References and tips

Electronic file

Electronic file Remarks, protocol and/or map (pdf) RDB06254.pdf

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test.
Please review the QC test results indicated by check icon as well as clone information before placing your order.

Test sheet RDB08129_A1Fgp1-1.pdf check

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV_Forward
Region: CMV pro,FLAG,insert 5'
Sequence file: RDB08129_A1Fga.seq check
>06254_08129_B1AjF_CMV-Forward_C10_07_ABI24.ab1
    1 NNNNNNNNNN NNNNNNNNNN NNNNTGGGCG GTAGGCGTGT ACGGTGGGAG GTCTATATAA
   61 GCAGAGCTCT CTGGCTAACT AGAGAACCCA CTGCTTACTG GCTTATCGAA ATTAATACGA
  121 CTCACTATAG GGAGACCCAA GCTGAATTCA CCATGGACTA CAAGGACGAT GACGATAAGG
  181 CGGCCATGAC TGCAAAGATG GAAACGACCT TCTATGACGA TGCCCTCAAC GCCTCGTTCC
  241 TCCCGTCCGA GAGCGGACCT TATGGCTACA GTAACCCCAA GATCCTGAAA CAGAGCATGA
  301 CCCTGAACCT GGCCGACCCA GTGGGGAGCC TGAAGCCGCA CCTCCGCGCC AAGAACTCGG
  361 ACCTCCTCAC CTCGCCCGAC GTGGGGCTGC TCAAGCTGGC GTCGCCCGAG CTGGAGCGCC
  421 TGATAATCCA GTCCAGCAAC GGGCACATCA CCACCACGCC GACCCCCACC CAGTTCCTGT
  481 GCCCCAAGAA CGTGACAGAT GAGCAGGAGG GCTTCGCCGA GGGCTTCGTG CGCGCCCTGG
  541 CCGAACTGCA CAGCCAGAAC ACGCTGCCNA GCGTCNCGTC NGCGGCGCAG CCGGTCAACG
  601 GGGCANGCAT GGTGGCTCCN GCGGTAGCCT CGGTGGNANG GGGCANCGGC AGCGGCNGCT
  661 TCNGCGCCNG CCNGNACANC GAGNCNNNNG TCTACNNNAA NNNCNNCNNC NTNNNNCNNN
721 NCNNNCTGAN NNNNNNNNN
//
Primer: bGH_rev3
Region: bGHpA,insert 3'
Sequence file: RDB08129_A1Fgb.seq check
>06254_08129_B1AjF_bGH_rev3_C11_08_ABI24.ab1
    1 NNNNNNNNNN NNNNNNNNNN NNNNNNGCAA ACNACAGATG GCTGGCAACT AGAAGGCACA
   61 GTCGAGGCTG ATCAGCGAGC TCTAGCATTT AGGTGACACT ATAGAATAGG GCCCTCTAGA
  121 TGCATGCTCG AGCGGCCTCA AAATGTTTGC AACTGCTGCG TTAGCATGAG TTGGCACCCA
  181 CTGTTAACGT GGTTCATGAC TTTCTGTTTA AGCTGTGCCA CCTGTTCCCT GAGCATGTTG
  241 GCCGTGGACG CCAGCTCCGA GTTCTGAGCT TTCAAGGTTT TCACTTTTTC CTCCAGCCGG
  301 GCGATTCTCT CCAGCTTCCT TTTTCGGCAC TTGGAGGCAG CGATGCGGTT CCTCATGCGC
  361 TTCCTCTCCG CCTTGATCCG CTCCTGGGAC TCCATGTCGA TGGGGGACAG GGGCGGTGTC
  421 TCGCCGGGCA TCTCGGGCAC TGTCTGAGGC TCCTCCTTCA GGGCCTGCAG CCGCGGGTGC
  481 TGCACGGGCA TCTGCTGGGG CAGGTGGTGC GGCGGCTGCT GCTGCTGCTG GGGTTGCGCG
  541 GGAAAGGCCA GGCCGGCCGC GCCGTANGAN GGCGCCCCGC CGCCGCTGCT CNGCGCGNCT
  601 GGGTTGAAGT TGCTGANGTT TGCGTANANC GGCGGCTCGC TGTGCNNGNT GGCGCTNNNN
  661 CNCCGCTGCC GCNGNCCCCN GNCNNCNNNN NNNNNCNNNN CNNNCNNGCN TGNCCCNNTN
721 ANCNGNTGNN CNNNNNANNT NNNNNNNGNN NNNNNNNN
//
Primer: SV40pro_ori_F
Region: SV40 pro_ori,NeoR
Sequence file: RDB08129_A1Fgc.seq check
>06254_08129_B1AjF_SV40pro_ori_F_C12_09_ABI24.ab1
    1 NNNNNNNNNN NNNNGNCGCC TCNGCCTCTG ANCTATTCCN GAAGTAGTGA GGAGGCTTTT
   61 TTGGAGGCCT AGGCTTTTGC AAAAAGCTCC CGGGAGCTTG GATATCCATT TTCGGATCTG
  121 ATCAAGAGAC AGGATGAGGA TCGTTTCGCA TGATTGAACA AGATGGATTG CACGCAGGTT
  181 CTCCGGCCGC TTGGGTGGAG AGGCTATTCG GCTATGACTG GGCACAACAG ACAATCGGCT
  241 GCTCTGATGC CGCCGTGTTC CGGCTGTCAG CGCAGGGGCG CCCGGTTCTT TTTGTCAAGA
  301 CCGACCTGTC CGGTGCCCTG AATGAACTGC AGGACGAGGC AGCGCGGCTA TCGTGGCTGG
  361 CCACGACGGG CGTTCCTTGC GCAGCTGTGC TCGACGTTGT CACTGAAGCG GGAAGGGACT
  421 GGCTGCTATT GGGCGAAGTG CCGGGGCAGG ATCTCCTGTC ATCTCACCTT GCTCCTGCCG
  481 AGAAAGTATC CATCATGGCT GATGCAATGC GGCGGCTGCA TACGCTTGAT CCGGCTACCT
  541 GCCCATTCGA CCACCAAGCG AAACATCGCA TCGAGCGAGC ACGTACTCGG ATGGAAGCCG
  601 GTCTTGTCGA TCANGANGAN CTGNNCNAAN ANCATCNNGG NCTCGCGCCN GCCNAACTGN
  661 TCGCCNGGCT NNNNNNNCGC ATGNCNNANN GCNANNNNNN CGNCNNGNNC NNNNNNNNNG
721 NNNGNNNNNN NNNN
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles


2021.02.16

GNP_filter3_RDBDEP_html_201222.pl