Resource data sheet


Expression vector of human JUN

Catalog number RDB06254
Resource name pCMFlag_hsJUN
Alternative name SET-0010_37
Clone info. Expression vector of human JUN. Expression was confirmed by Western blotting with anti-FLAG antibody.
F-primer: atgactgcaaagatggaaacg; R-primer: tcaaaatgtttgcaactgctg.
Vector backbone pCMV_S-FLAG (Plasmid)
Size of vector backbone 5.5 kb
Selectable markers Amp^r (E. coli), Neo^r (mammalian cell)
Gene/insert name Human c-jun cDNA
Depositor DNA Bank, |
Other clones in our bank human JUN (NCBI Gene 3725) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR The RECIPIENT agrees to describe RIKEN BRC as the source of the MATERIAL in any publication.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Shipping form Fee (non-profit org.)
RDB06254 pCMFlag_hsJUN DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file PDF RDB06254.pdf from Depositor

Featured content

Featured content pCMV_tag and pRSV_tag assay-ready clones (English text)


User reports and related articles (go to bottom)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB08129_A4L8p1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: CMV-Forward RDB08129_A4L8a.seq
Primer: BGH_rev RDB08129_A4L8b.seq
Primer: SV40pro_F_V2 RDB08129_A4L8c.seq

Please visit Sequencing and PCR primers for primer information.


