Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pKM2L-phALP1

Promoter Bank clone, Human placental-likee alkaline phosphatase (ALP-1) 532aa promoter

Catalog number RDB05903
Resource name pKM2L-phALP1
Alternative name p1989-1F
Clone info. PCR amplified human placental-likee alkaline phosphatase (ALP-1) 532aa promoter sequence was inserted into a Renilla luciferase reporter vector pKM2L (RDB04026). Cloned fragment: 232406140 to 232406885(NC_000002.12 ); relatively -702 to +44, where +1 corresponds to 1 nt of NM_031313.3.
PCR cloning, forward primer, 1989 F2: 5' ggactctcccccactgcgtcgtcca 3'; reverse primer, 1989 R2: 5' cagtcggagagcggcgaggcggaaa 3' (reference: Cancer Res., 52, 3378-3383, 1992, PMID:1596896; J. Biol. Chem., 263, 12020-12027, 1988, PMID:3042787) Entire sequence of promoter region has not been confirmed.
Vector backbone pKM2L (RDB04026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human alkaline phosphatase, placental-like 2 genomic DNA
Reference of nucleotide sequence AC068134 (DDBJ accession number)
Depositor|Developer DNA Bank, |
 
Other clones in our bank human ALPPL2 (NCBI Gene 251) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB05903 pKM2L-phALP1 Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Promoter Collection (Renilla Luciferase) (English text)

Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


References

Original, user report and related articles


2020.02.12

GNP_filter3_RDBDEP_html_191130.pl