Resource data sheet
Prev.

pKM2L-phSOX17

Promoter Bank clone, Human SRY (sex determining region Y)-box 17 (SOX17) promoter

Catalog number RDB05897
Resource name pKM2L-phSOX17
Alternative name p1982-7F
Clone info. The Human SRY (sex determining region Y)-box 17 (SOX17) promoter sequence (PCR-amplified 3,304 bp) was inserted into a Renilla luciferase reporter vector pKM2L (RDB4026).
Forward primer, 1982 F2: 5' cgaccctggaccgtgcagtgctaac 3'; Reverse primer, 1982 R2: 5' gggtggggagtgaggcactgagatg 3' Entire sequence of promoter region has not been confirmed. (reference: Int. J. Mol. Med., 9, 153-157, 2002, PMID:11786926)
Vector backbone pKM2L (RDB4026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human SRY (sex determining region Y)-box 17 genomic DNA
Reference of nucleotide sequence AC091076 (DDBJ accession number)
Depositor DNA Bank, |
 
Other clones in our bank human SOX17 (NCBI Gene 64321) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB05897 pKM2L-phSOX17 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file Sequence RDB05897z.seq from Depositor

Featured content

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References


2018.12.10

GNP_filter3_RDBDEP_html_181012.pl