Resource data sheet
Prev.

pKM2L-phK5

Promoter Bank clone, Human keratin K5 promoter

Catalog number RDB05886
Resource name pKM2L-phK5
Alternative name p1931-27F
Clone info. The Human keratin K5 promoter sequence (PCR-amplified 6.3 kb) was inserted into a Renilla luciferase reporter vector pKM2L (RDB4026). Genomic DNA (52,520,363 to 52,526,648nt of NC_000012.12) corresponding to 1 to 97nt of NM_000424.3 and 6.2 kb up-stream was cloned.
Forward primer, 1931 F-SpeI: 5' gactactagtgaattctaactccttattatcagcc 3'; Reverse primer, 1931 R-SalI: 5' gactgtcgacgagctcagcaggacgcagaaggtgg 3' Entire sequence of promoter region has not been confirmed. (reference: Mol. Cell. Biol., 13, 3176-3190, 1993, PMID:7684490; Mol. Cell. Biol., 9, 3685-3697, 1989, PMID:2476664)
Vector backbone pKM2L (RDB4026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human keratin 5 genomic DNA
Reference of nucleotide sequence AC055736 (DDBJ accession number)
Depositor DNA Bank, |
 
Other clones in our bank human KRT5 (NCBI Gene 3852) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB05886 pKM2L-phK5 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

Featured content Dnaconda's recommendation EXR0015j (Japanese text)

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB17218_A9Dbp1-1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: M13_-40 RDB17218_A9Dba.seq
>05886_17218_A9Db_2_M13_-40_A01_01_ABI08.ab1
    1 AAGGCCAGGG CCAGGCTTGC ATGCCTGCAG GTCATTTAAA TAGGGATAAC AGGGTAATGA
   61 TTAAGATCTC GAGCTCTAAG CTTCACATAT GCATGCACTA GTGAATTCTA ACTCCTTATT
  121 ATCAGCCACT GGAGTAGAGG CGATCAGCGT CTGCAGACTG GTGGGACCTC ATGGCCTAGA
  181 GCAGACAAAT GCCTTGGAGG AACAGGCTTC GGTGCTAACT TAGGCTTGAA GGCCAGTCTG
  241 CTCCCTGGAA AGACCCAGAC CAGCACCTGG ACATGAGGGC TCTGGACAGG GGAGGGGTGG
  301 GGAGCAGTAA AAACACCCTC ACCCATCACA GTCACCTGTC AGCCCTGTCA TGCACACAGC
  361 CCTCGGGAAA TGGCTCTCTG AAGAGGACTG AGACGTGCAG CCTTGGACTG GGAGACAAGT
  421 AGGCTCTTGC TGAGGCCCAG ATGGGCAGTG CAGGGCAACA ACAGCGTGTG GGACAGGACC
  481 AGGACCCAGG CTTGGCTCTC ACCTCACCTT GCCAAGGGCT TGGCGTTAGG CTCCACCTCC
  541 CTGAACTCAG CCTGTTCCTC TATGGATGGA TCACTGGGCT GGTTTTTTTC TCTGAAACCA
  601 AGTCAGGCCA GCTTCCCTAA CCCGGCCCTT GCACAGTGAC CCGTCACTGT CAAGTGGTGT
  661 GGGCCACCAT CCTGGGTCTG GTAAGGAGAT CCTAGAGGAG ACCCAGCCCT GTTCGCAGTC
  721 CTGGAGTCTG AGGGAGGAAA TGGGGAAGGG TACAGGGTCA CACAACCAGA GTCCAGAAGT
  781 CCAGTGCATG GCATCTGCCT TGGCCAAGTC ACACATGTGG AACAGGACCT GATTCAATGA
  841 CTGGCATGAA TTGAAACACT CCTGCACGCT CTCTTGTCTC AGTTGCTTTT TGCACTGCGT
  901 CTCCCTTGGA AGAAGCCTTA ACCTGTTTTC ACAAACCCTC AACAGTGATC GTTGGTCCAA
  961 GTGGACAGTG AGCAGGTCAG TGTTCACATG TGCTCACGGA ACATGAAGAT GGGAGCTGCG
 1021 AGTGTGTCCT GGAGTCTGAG GGAGGAAATG GGGAAAGGAC ACAGGGTCAC AGTCTCACAT
 1081 AGACGTGGAC TGGGGCCAGC AAGGTGTTCC CAATGGCCTT GAGGACTGTG CAGAATGCCG
 1141 AGTGCATTCT GAGGGTGGAC CTGGGGAGAA GCACAGCTTC AAGTCTTCAT GCCTGTCCAT
1201 TTAACGTTCC CTTATTCTTG CTG
//
Primer: phRLR2primer RDB17218_A9Dbb.seq
>05886_17218_A9Db_2_phRLR2primer_B01_02_ABI08.ab1
    1 ATTTTCCCTT GTCTCGACAG CCCAGTTTCT ATTGGTCTCC TTAAACCTGT CTTGTAACCT
   61 TGATACTTAC CTGCCCAGTG CCTCACGACC AACTTCTGCA GTACCCGGGT GAATTCTACG
  121 CGTCGACGAG CTCAGCAGGA CGCAGAAGGT GGCTCTGTTA CCCAGGAACG GTGATGCCCC
  181 CTTTTTATCC CTTCCAGAAC TGGGCTGGGC GAGAGAGCTG TCGAGCTGTG AATGATTAAG
  241 TGGGCTGGGC ATGCCTGGGG GGCAGCTGTG AGCTCACCGG TCACACCTGC ACAGTGGTGT
  301 GGGGTGCAAA CGCTTTCTTC CTGGCAGGCT CTGCTCAGTT AGAAATAACC TTGCCTTGCA
  361 GCACTGATCT CTTGGCAGCA AGTTGGTGAC GCTGCTAGCA AGTATGTCTT CACCATAGAG
  421 GCTGGGGGCT GTGAGCAGCC CAAAAAGGAT GCCAGGAACT GAGGGGGCAT TGGCATGGCC
  481 AGTGTCCTGG GGACTCTTAC AGGACCAGGA GTATTGACAA CCATCCCAGT ACGGTACATG
  541 CTGAGCACCT GCCCTTCCAG CTTGGGGAAG CTGTCCATCA GCGGGGGGCA AACGATTCCC
  601 CAGTGATCTG CTCTTACACT TTTCCAGGCA GCAGGTTGCT GCAGGGTTTT CCCCTCTGGG
  661 AAAGGCAATC TGTAGCCTTA TATTCTTGGT TATGTGCTAG AGGGAAAATA GAGTTTCATC
  721 CTTTTCTGCA CAATTTTTTT CTTAGGGAAG GCACAGCTAT CCCAGAGCCC ACTGGGCAGA
  781 TCTGCCTGCA AGGTTTAGGC CAGAGAATGT GGGAAGCCCT CAGCGCCCCC TATAAACCAC
  841 TTTGACCTCT TTAAGGCCAG GTTTATCCTT CCATAGCTCC TCCTAACTCA GCATTTTTTC
  901 TGCCCTTTGA CCTTTTCCTT GCTCTTTGGC CTGGGGCAGG ACTCTGTGGG GGGTTTAGGA
  961 AACCCGGGGA TCCCATGCAA TCCCTTAAAA AAAAACCCTG ACACTCATGG GCTATAGCGT
 1021 CTCTCTTTGG GGGTAGCTAC TCTGCCGGGT TCCCCAGCCC CCCAGGTGTG TTCCAGCAAG
 1081 CTCTATTCCA CTAGGAAGAA ATGAGTCATC GTATGTGTTG ATACAGCTGA GCCGCCCACA
 1141 AAACAACATA CTGCAGAGCT TCTATCTCAT CAGACCATGT GAGAGTCTGG ACGGTCTTGT
1201 TATAACCGGC GGAAACACAC ACCCTGGT
//
Primer: pAxCALNLF1 RDB17218_A9Dbc.seq
>05886_17218_A9Db_2_pAxCALNLF1_C01_03_ABI08.ab1
    1 CAACCAAATG AATCTTATCC ATGTCTGCTC GAAGCGGCCG CTCTAGAATT ACTGCTCGTT
   61 CTTCAGCACG CGCTCCACGA AGCTCTTGAT GTACTTACCC ATTTCATCTG GAGCGTCCTC
  121 CTGGCTGAAG TGGAGGCCCT TCACCTTCAC GAACTCGGTG TTAGGGAACT TCTTAGCTCC
  181 CTCGACAATA GCGTTGGAAA AGAACCCAGG GTCGGACTCG ATGAACATCT TAGGCAGATC
  241 GTCGCTGGCC CGAAGGTAGG CGTTGTAGTT GCGGACAATC TGGACGACGT CGGGCTTGCC
  301 TCCCTTAACG AGAGGGATCT CGCGAGGCCA GGAGAGGGTA GGCCGTCTAA CCTCGCCCTT
  361 CTCCTTGAAT GGCTCCAGGT AGGCAGCGAA CTCCTCAGGC TCCAGTTTCC GCATGATCTT
  421 GCTTGGGAGC ATGGTCTCGA CGAAGAAGTT ATTCTCAAGC ACCATTTTCT CGCCCTCTTC
  481 GCTCTTGATC AGGGCGATAT CCTCCTCGAT GTCAGGCCAC TCGTCCCAGG ACTCGATCAC
  541 GTCCACGACA CTCTCAGCAT GGACGATGGC CTTGATCTTG TCTTGGTGCT CGTAGGAGTA
  601 GTGAAAGGCC AGACAAGCCC CCCAGTCGTG GCCCACAAAG ATGATTTTCT TTGGAAGGTT
  661 CAGCAGCTCG AACCAAGCGG TGAGGTACTT GTAGTGATCC AGGAGGCGAT ATGAGCCATT
  721 CCCGCTCTTG CCGGACTTAC CCATTCCGAT CAGATCAGGG ATGATGCATC TAGCCACGGG
  781 CTCGATGTGA GGCACGACGT GCCTCCACAG GTAGCTGGAG GCAGCGTTAC CATGCAGAAA
  841 AATCACGGCG TTCTCGGCGT GCTTCTCGGA ATCATAGTAG TTGATGAAGG AGTCCAGCAC
  901 GTTCATTTGC TTGCAGCGAG CCCACCACTG AGGCCCAGTG ATCATGCGTT TGCGTTGCTC
  961 GGGGTCGTAC ACCTTGGAAG CCATGGTGGC TAGCCTATAG TGAGTCGTAT TAAGTACTCT
 1021 AGCCTTAAGA GCTGTAATTG AACTGGAGTG GACACTGTGG AGAGAAAGGC AAAGGGATGT
 1081 CAGTAAGACC ATAGGTGCCT ATCAGAAACG GCAAGAGTCT CTCTGTCTCG ACAAGCCCAG
 1141 TTTCTTATAT CCTCTTAACC TTGTCTTGGT AACTTGATAC TAACCTGGCC AAGTTGCCTT
1201 CACGGAACAA ACTTCTGTGC AGATTTACCT CCG
//

Please visit Sequencing and PCR primers for primer information.


References

References

user report Tanaka, S., Functional conservation of Gsdma cluster genes specifically duplicated in the mouse genome. G3 (Bethesda), 3 (10): 1843-1850 (2013). PMID 23979942.

2019.04.24

GNP_filter3_RDBDEP_html_190327.pl