Resource data sheet
Prev.

pKM2L-phK5

Promoter Bank clone, Human keratin K5 promoter

Catalog number RDB05886
Resource name pKM2L-phK5
Alternative name p1931-27F
Clone info. The Human keratin K5 promoter sequence (PCR-amplified 6.3 kb) was inserted into a Renilla luciferase reporter vector pKM2L (RDB4026). Genomic DNA (52,520,363 to 52,526,648nt of NC_000012.12) corresponding to 1 to 97nt of NM_000424.3 and 6.2 kb up-stream was cloned.
Forward primer, 1931 F-SpeI: 5' gactactagtgaattctaactccttattatcagcc 3'; Reverse primer, 1931 R-SalI: 5' gactgtcgacgagctcagcaggacgcagaaggtgg 3' Entire sequence of promoter region has not been confirmed. (reference: Mol. Cell. Biol., 13, 3176-3190, 1993, PMID:7684490; Mol. Cell. Biol., 9, 3685-3697, 1989, PMID:2476664)
Vector backbone pKM2L (RDB4026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human keratin 5 genomic DNA
Reference of nucleotide sequence AC055736 (DDBJ accession number)
Depositor DNA Bank, |
 
Other clones in our bank human KRT5 (NCBI Gene 3852) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB05886 pKM2L-phK5 DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

Featured content Dnaconda's recommendation EXR0015j (Japanese text)

References

User reports and related articles (go to bottom)


Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB07923_A3H6p1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: M13_-40 RDB07923_A3H6a.seq
>05886_07923_A3H6_M13(-40)_A01_01.ab1
    1 CCGGCCAGCG CCAGCTTGCA TGCCTGCAGG TCATTTAAAT AGGGATAACA GGGTAATGAT
   61 TAAGATCTCG AGCTCTAAGC TTCACATATG CATGCACTAG TGAATTCTAA CTCCTTATTA
  121 TCAGCCACTG GAGTAGAGGC GATCAGCGTC TGCAGACTGG TGGGACCTCA TGGCCTAGAG
  181 CAGACAAATG CCTTGGAGGA ACAGGCTTCG GTGCTAACTT AGGCTTGAAG GCCAGTCTGC
  241 TCCCTGGAAA GACCCAGACC AGCACCTGGA CATGAGGGCT CTGGACAGGG GAGGGGTGGG
  301 GAGCAGTAAA AACACCCTCA CCCATCACAG TCACCTGTCA GCCCTGTCAT GCACACAGCC
  361 CTCGGGAAAT GGCTCTCTGA AGAGGACTGA GACGTGCAGC CTTGGACTGG GAGACAAGTA
  421 GGCTCTTGCT GAGGCCCAGA TGGGCAGTGC AGGGCAACAA CAGCGTGTGG GACAGGACCA
  481 GGACCCAGGC TTGGCTCTCA CCTCACCTTG CCAAGGGCTT GGCGTTAGGC TCCACCTCCC
  541 TGAACTCAGC CTGTTCCTCT ATGGATGGAT CACTGGGCTG GTTTTTTTCT CTGAAACCAA
  601 GTCAGGCCAG CTTCCCTAAC CCGGCCCTTG CACAGTGACC CGTCACTGTC AAGTGGTGTG
  661 GGCCACCATC CTGGGTCTGG TAAGGAGATC CTAGAGGAGA CCCAGCCCTG TTCGCAGTCC
  721 TGGAGTCTGA GGGAGGAAAT GGGGAAGGGT ACAGGGTCAC ACAACCAGAG TCCAGAAGTC
  781 CAGTGCATGG CATCTGCCTT GGCCAAGTCA CACATGTGGA ACAGGACCTG ATTCAATGAC
  841 TGGCATGAAT TGAAACACTC CTGCACGCTC TCTTGTCTCA GTTGCTTTTT GCACTGCGTC
  901 TCCCTTGGAA GAAGCCTTAA CCTGTTTTCA CAAACCCTCA ACAGTGATCG TTGGTCCAAG
  961 TGGACAGTGA GCAGGTCAGT GTTCACATGT GCTCACGGAA CATGAAGATG GGAAGCTGCG
 1021 AGTGTGTCCT GCAGTCTGAG GGAGGAAATG GGGGAAGGAC ACAGGTCACA GTCTCACATA
 1081 GACGGTGGGA CTGGGGGCCA GCAAGTGTCC ATTGACATGG AGACTGTGCA GATGCCGAGC
1141 TGCAATTTTC CTGGAAGGGG TGGATCT
//
Primer: phRLR2 RDB07923_A3H6b.seq
>05886_07923_A3H6_phRLR2_B01_04.ab1
    1 AACTTCTTGT CTCGACAGCC CAGTTTCTAT TGGTCTCCTT AAACCTGTCT TGTAACCTTG
   61 ATACTTACCT GCCCAGTGCC TCACGACCAA CTTCTGCAGT ACCCGGGTGA ATTCTACGCG
  121 TCGACGAGCT CAGCAGGACG CAGAAGGTGG CTCTGTTACC CAGGAACGGT GATGCCCCCT
  181 TTTTATCCCT TCCAGAACTG GGCTGGGCGA GAGAGCTGTC GAGCTGTGAA TGATTAAGTG
  241 GGCTGGGCAT GCCTGGGGGG CAGCTGTGAG CTCACCGGTC ACACCTGCAC AGTGGTGTGG
  301 GGTGCAAACG CTTTCTTCCT GGCAGGCTCT GCTCAGTTAG AAATAACCTT GCCTTGCAGC
  361 ACTGATCTCT TGGCAGCAAG TTGGTGACGC TGCTAGCAAG TATGTCTTCA CCATAGAGGC
  421 TGGGGGCTGT GAGCAGCCCA AAAAGGATGC CAGGAACTGA GGGGGCATTG GCATGGCCAG
  481 TGTCCTGGGG ACTCTTACAG GACCAGGAGT ATTGACAACC ATCCCAGTAC GGTACATGCT
  541 GAGCACCTGC CCTTCCAGCT TGGGGAAGCT GTCCATCAGC GGGGGGCAAA CGATTCCCCA
  601 GTGATCTGCT CTTACACTTT TCCAGGCAGC AGGTTGCTGC AGGGTTTTCC CCTCTGGGAA
  661 AGGCAATCTG TAGCCTTATA TTCTTGGTTA TGTGCTAGAG GGAAAATAGA GTTTCATCCT
  721 TTTCTGCACA ATTTTTTTCT TAGGGAAGGC ACAGCTATCC CAGAGCCCAC TGGGCAGATC
  781 TGCCTGCAAG GTTTAGGCCA GAGAATGTGG GAAGCCCTCA GCGCCCCCTA TAAACCACTT
  841 TGACCTCTTT AAGGCCAGGT TTATCCTTCC ATAGCTCCTC CTAACTCAGC ATTTTTTCTG
  901 CCCTTTGACC TTTTCCTTGC TCTTTGGCCT GCGCAGGACT CTGTGGGGGG GTTTAGGAAA
  961 CCCGGGGATC CCATGCAATC CCTTAAAAAA AAAACCCCTG ACACTCATGG GCTATAGCGT
 1021 CTCTCTTTGG GGGGTAGCTA CTCTGCCGGG TTCCCCAGCC CCCCCAGTGT GTTCAGCAGC
 1081 TCTATTCCAC TAGGAGGATG AGTCATCGTA TGTGTTGATA CAGGCTGAGG CGCCACAACA
1141 CATACCTGCC AGGGAGCTTT CTAAATTCCT CAATCTCA
//
Primer: pAXCALNLF1 RDB07923_A3H6c.seq
>05886_07923_A3H6_pAxCALNL_F1_G03_21_ABI24.ab1
    1 TATTTTCATT ATCATGGTCT GCTCGAGCGG CCGCTCTAGA ATTACTGCTC GTTCTTCAGC
   61 ACGCGCTCCA CGAAGCTCTT GATGTACTTA CCCATTTCAT CTGGAGCGTC CTCCTGGCTG
  121 AAGTGGAGGC CCTTCACCTT CACGAACTCG GTGTTAGGGA ACTTCTTAGC TCCCTCGACA
  181 ATAGCGTTGG AAAAGAACCC AGGGTCGGAC TCGATGAACA TCTTAGGCAG ATCGTCGCTG
  241 GCCCGAAGGT AGGCGTTGTA GTTGCGGACA ATCTGGACGA CGTCGGGCTT GCCTCCCTTA
  301 ACGAGAGGGA TCTCGCGAGG CCAGGAGAGG GTAGGCCGTC TAACCTCGCC CTTCTCCTTG
  361 AATGGCTCCA GGTAGGCAGC GAACTCCTCA GGCTCCAGTT TCCGCATGAT CTTGCTTGGG
  421 AGCATGGTCT CGACGAAGAA GTTATTCTCA AGCACCATTT TCTCGCCCTC TTCGCTCTTG
  481 ATCAGGGCGA TATCCTCCTC GATGTCAGGC CACTCGTCCC AGGACTCGAT CACGTCCACG
  541 ACACTCTCAG CATGGACGAT GGCCTTGATC TTGTCTTGGT GCTCGTAGGA GTAGTGAAAG
  601 GCCAGACAAG CCCCCCAGTC GTGGCCCACA AAGATGATTT TCTTTGGAAG GTTCAGCAGC
  661 TCGAACCAAG CGGTGAGGTA CTTGTAGTGA TCCAGGAGGC GATATGAGCC ATTCCCGCTC
  721 TTGCCGGACT TACCCATTCC GATCAGATCA GGGATGATGC ATCTAGCCAC GGGCTCGATG
  781 TGAGGCACGA CGTGCCTCCA CAGGTAGCTG GAGGCAGCGT TACCATGCAG AAAAATCACG
  841 GCGTTCTCGG CGTGCTTCTC GGAATCATAG TAGTTGATGA AGGAGTCCAG CACGTTCATT
  901 TGCTTGCAGC GAGCCCACCA CTGAGGCCCA GTGATCATGC GTTTGCGTTG CTCGGGGTCG
  961 TACACCTTGG AAAGCCCATG GTGGGCTAGC CCTATAGTGA GTCGTTATAA GTTACTCTAG
 1021 CCCTAAAGAG CTGTATGGAC CTGGGAGTTG GACACCTGTT GGAGAGAAGG CAAAAGGTGG
//

Please visit Sequencing and PCR primers for primer information.


References

References

user report Tanaka, S., Functional conservation of Gsdma cluster genes specifically duplicated in the mouse genome. G3 (Bethesda), 3 (10): 1843-1850 (2013). PMID 23979942.

2018.11.01

GNP_filter3_RDBDEP_html_181012.pl