Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pKM2L-phGHRF

Promoter Bank clone, Human growth hormone-releasing factor (GHRH/GHRF/GRF) promoter

Catalog number RDB05540
Resource name pKM2L-phGHRF
Alternative name p1958-5F
Clone info. PCR amplified human growth hormone-releasing factor (GHRH/GHRF/GRF) promoter sequence was inserted into a Renilla luciferase reporter vector pKM2L (RDB04026). Cloned fragment: 37262905 to 37261763(NC_000020.11); relatively -5997 to -4854, where +1 corresponds to 1 nt of NM_021081.5; relatively -1088 to +55, where +1 corresponds to 1 nt of XM_011528788.2.
PCR cloning forward primer, 1958 F2: 5' tagactcgaggcttggagctctttc 3'; reverse primer, 1958 R2: 5' ctgctccgaggcactgctcaaatc 3'; Entire sequence of promoter region has not been confirmed. Promoter activity has not been analyzed.
Vector backbone pKM2L (RDB04026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human growth hormone releasing hormone genomic DNA
Reference of nucleotide sequence AL034422 (DDBJ accession number)
Depositor|Developer DNA Bank, |
 
Other clones in our bank human GHRH (NCBI Gene 2691) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB05540 pKM2L-phGHRF Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content


Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


References

Original, user report and related articles


2020.02.12

GNP_filter3_RDBDEP_html_191130.pl