Resource data sheet
Please review the QC test results indicated by check icon below as well as clone information before placing your order.


Promoter Bank clone, Human somatomammotropin (hCS-1) promoter

Catalog number RDB05531
Resource name pKM2L-phCS1
Alternative name p1948-4F
Clone info. Pending.
Forward primer, D10PB0076F: 5' gaattcaggactcaatggtgctcag 3'; Reverse primer, D10PB0076R: 5' tgccactaggtgagctgtccacagg 3' Entire sequence of promoter region has not been confirmed.
Vector backbone pKM2L (RDB04026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human genomic DNA
Depositor|Developer DNA Bank, |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]

Catalog # Resource name Availability
RDB05531 pKM2L-phCS1 To be determined. Please contact us.

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Promoter Collection (Renilla Luciferase) (English text)

Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


Original, user report and related articles
