Resource data sheet
Prev.

pKM2L-phIL1B

Promoter Bank clone, Human interleukin 1 beta (IL1B) promoter

Catalog number RDB05526
Resource name pKM2L-phIL1B
Alternative name p1941-3F
Clone info. The Human interleukin 1 beta (IL1B) promoter sequence (PCR-amplified 3,791 bp) was inserted into a Renilla luciferase reporter vector pKM2L (RDB4026). Genomic sequence from 55967 to 52177 (reverse direction) of AC09753.7 corresponding -3757 to +13 (the transcription start site is designated +1. Fig. 1 of Shirakawa, F. Mol. Cell. Biol 13 (3) 1332-1344, 1993 and Fig.1 of Kominato, Y. Mol. Cell. Biol. 15 (1) 58-68, 1995) is cloned.
Forward primer, 1941 F2: 5' tctagaccagggaggagaatggaatg 3'; Reverse primer, E9PB0069R: 5' gaagaggtttggtatctgccagtttc 3'; Entire sequence of promoter region has not been confirmed.
Vector backbone pKM2L (RDB4026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human interleukin 1 beta (IL1B) genomic DNA
Depositor DNA Bank, |
 
Other clones in our bank human IL1B (NCBI Gene 3553) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB05526 pKM2L-phIL1B DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Electronic file Map RDB05526a.gif from Depositor
Electronic file Remarks, protocol and/or map (pdf) RDB05526.pdf from Depositor

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content

Featured content Dnaconda's recommendation EXR0092e (English text)
Featured content Dnaconda's recommendation EXR0092j (Japanese text)
Featured content Promoter Collection (Renilla Luciferase) (English text)

Sequence information

RIKEN BRC has sequenced portions of this material for quality test. Primers and the results are shown below.

Data are summerized on test sheet below.

Test sheet RDB12399_A5Iop1.pdf

Nucleotide sequence of a portion of this resource (if available).

Primer: M13_-40 | Sequence: RDB12399_A5Ioa.seq
>05526_12399_A5Io_2_M13(-40)_G12_21.ab1
    1 AGGCGGCGCA GCTTGCATGC CTGCAGGTCA TTTAATAGGG ATAACAGGGT AATGATTAAG
   61 ATCTCGAGCT CTAAGCTTCA CATATGCATG CACTAGTGGC TCTAGACCAG GGAGGAGAAT
  121 GGAATGTTCC TTGGACTCTG CATGTCCCCA ATCTGAGAAC CTGGATCCAA GAGGGAGAAG
  181 AAGCCCATTG GAGATGATGC CATAAAGGAA GTGGAAGCGA TATGATAAAA ATCATAGTGC
  241 CCATTCCCAA ATAATCCCAG AAGCAGAAGG GAAAGGAGAG AAATATCCAC AAAGACAGGT
  301 GTGGGTACAC ACAACATTTT TCATACTTTA AGATCCCAGA GGGACTCATG GAAATGATAC
  361 AAGAAAATGA CTCATAAGAA CAAATATTAG GAAGCCAGTG CCAAGAATGA GATGGGAAAT
  421 TGGGGAAAAT GTTGGGGGCA GATTGCTTAG TTCTGTTCTA AGCAAGAGGG TGAACAAGGA
  481 AGGAACAGCT CACTACAAAG AACAGACATC ACTGCATGTA CACACAATAA TATAAGAACT
  541 AACCCATGAT TATTTTGCTT GTCTTCTTGT TCAAAATGAT TGAAGACCAA TGAGATGAGA
  601 TCAACCTTGA TAACTGGCTG CGAAGCCCAT GATTAGACAC AAGATGGTAT CAGGGCACTT
  661 GCTGCTTTGA ATAAATGTCA GTCTCCTGTC TTGGAAGAAT GACCTGACAG GGTAAAGAGG
  721 AACTTGCAGC TGAGAAAGGC TTTAGTGACT CAAGAGCTGA ATAATTCCCC AAAAGCTGGA
  781 GCATCCTGCA TTTCCAGCTC CCCATCTCTG CTTGTTCCAC TTCCTTTGGG GCTACATCAC
  841 ATCTACATCA TCATCACTCT TCCACTCCCT CCCTAGTGCC AACTATGTTT ATAGCGAGAT
  901 ATTTCTGCTC ATTGGGGAAT CGAGAGGAAG TGCTGTGACT TGAGCGTCTC GTGGAGACAG
  961 ATCTGATACA TACGTGCACA CCTATTGACA TAGAAGTTTC ACTCTGAATG AATGATGATA
1021 ACAATTGGTC AGTTACAGAC AGATGGACAT GCCAAATTCG TTGCGATC
//
Primer: phRLR2 | Sequence: RDB12399_A5Iob.seq
>05526_12399_A5Io_2_phRLR2_H12_24.ab1
    1 AACTTTATTT GTCTCGAAAG CCAGTTTCTA TTGGTCTCCT TAAACCTGTC TTGTAACCTT
   61 GATACTTACC TGCCCAGTGC CTCACGACCA ACTTCTGCAG TACCCGGGTG AATTCTACGC
  121 GTCGACAGGC GAAGAGGTTT GGTATCTGCC AGTTTCTCCC TCGCTGTTTT TATAGCTTTC
  181 AAAAGCAGAA GTAGGAGGCT GAGAAATTTC TCTGTTGAAT ACCTGATTTC ACAATCAAGT
  241 TAAAGGAAAG GGGAAAAGAG TATTGGTGGA AGCTTCTTAG GGGAGGGGAC TAATAAACTG
  301 AGATAATTCT CTGGTTCATG GAAGGGCAAG GAGTAGCAAA CTATGACACA TTTTGCAAAT
  361 GTATCACCAT GCAAATATGC ATTGTTTTCC TGACAATCGT TGTGCAGTTG ATGTCCACAT
  421 TAAAATACTG GATTTTCCCA CGTTAGAAGA ATGTTTAAAT TTAGTATATG TGGGACAAAG
  481 TGGAAGACAC ACAGATTTAT ACATGCACAT ACTTTTCTTC ATTCACTTCT TTGTACTTAA
  541 GTTTAGGAAT CTTCCCACTT ACAGATGGAT AAATGGGTAC AATGAAGGGC CAATAGCCCT
  601 CCCTGTCTGT ATTGAGGGTG TGGGTCTCTA CCTTGGGTGC TGTTCTCTGC CTCGGGAGCT
  661 CTCTGTCAAT TGCAGGAGCC TCTGAGGAGA AAATTGACCT TTCTTGGCTG GGGCAGAGAA
  721 CATACGGTAT GCAGGGTTCA GGCTCCTGAC GGAGTTGGGG CAACCCTGGA GATAAGCTCA
  781 CACAACCCTG CAAGACCAGG TGCTGTTACC CTAGCCAATC TCATGGATGA ACCAGATCAA
  841 TGCCAGATGA GCTCTGCCTA AAATGATTTT TTTGGTGAAC TCTGAAAAGT GGAATATTGT
  901 TTCTGTAAGA ATATCCATCT GAGACTCTAT CTCTTGGTAA TACCAAGAGT TATCAGTTTC
  961 TCTTTAACCG AGACACCAGC AAAGTGCCTG CTCCAGGGTA CTGCCCAGGG GAGCCCTCCA
 1021 TTTGTAGAAT GAATGAGAGT CCAGGTTATG ACAGTGCCTG CAGTGTAGGA CACTCCTCCT
 1081 TTGCTCTTTG ACAGTCTGCA ATCAATACAC GTTTTTTTTT TTGAGACCGA TTCTCAACTC
1141 TGATCGCCCT AGGCCCTGGG GAGGTTGCCG TTGC
//
Primer: pAxCALNL_F1 | Sequence: RDB12399_A5Ioc.seq
>05526_12399_A5Io_2_pAxCALNL_F1_H11_23.ab1
    1 ACAATGAATC TTATCATGTC TGCTCGAAGC GGCCGCTCTA GAATTACTGC TCGTTCTTCA
   61 GCACGCGCTC CACGAAGCTC TTGATGTACT TACCCATTTC ATCTGGAGCG TCCTCCTGGC
  121 TGAAGTGGAG GCCCTTCACC TTCACGAACT CGGTGTTAGG GAACTTCTTA GCTCCCTCGA
  181 CAATAGCGTT GGAAAAGAAC CCAGGGTCGG ACTCGATGAA CATCTTAGGC AGATCGTCGC
  241 TGGCCCGAAG GTAGGCGTTG TAGTTGCGGA CAATCTGGAC GACGTCGGGC TTGCCTCCCT
  301 TAACGAGAGG GATCTCGCGA GGCCAGGAGA GGGTAGGCCG TCTAACCTCG CCCTTCTCCT
  361 TGAATGGCTC CAGGTAGGCA GCGAACTCCT CAGGCTCCAG TTTCCGCATG ATCTTGCTTG
  421 GGAGCATGGT CTCGACGAAG AAGTTATTCT CAAGCACCAT TTTCTCGCCC TCTTCGCTCT
  481 TGATCAGGGC GATATCCTCC TCGATGTCAG GCCACTCGTC CCAGGACTCG ATCACGTCCA
  541 CGACACTCTC AGCATGGACG ATGGCCTTGA TCTTGTCTTG GTGCTCGTAG GAGTAGTGAA
  601 AGGCCAGACA AGCCCCCCAG TCGTGGCCCA CAAAGATGAT TTTCTTTGGA AGGTTCAGCA
  661 GCTCGAACCA AGCGGTGAGG TACTTGTAGT GATCCAGGAG GCGATATGAG CCATTCCCGA
  721 TCTTGCCGGA CTTACCCATT CCGATCAGAT CAGGGATGAT GCATCTAGCC ACGGGCTCGA
  781 TGTGAGGCAC GACGTGCCTC CACAGGTAGC TGGAGGCAGC GTTACCATGC AGAAAAATCA
  841 CGGCGTTCTC GGCGTGCTTC TCGGAATCAT AGTAGTTGAT GAAGGAGTCC AGCACGTTCA
  901 TTTGCTTGCA GCGAGCCCAC CACTGAGGCC CAGTGATCAT GCGTTTGCGT TGCTCGGGGT
  961 CGTACACCTT GGAAGCCATG GTGGCTAGCC TATAGTGAGT CGTATTAAGT ACTCTAGCCC
 1021 TTAAGAGCTG TAATTGAACT GGGGAGTGGA CACCCTGGTG GAGAGAGGCA AAGTGGATGT
 1081 CAGTAGACCC ATAGGGTGCC TTATTCGAAC GCAGGAGTCA CCTCTGTTCT CGACAAGCCC
1141 AGATTCTATT TGGAATCCTC CATA
//

Please visit Sequencing and PCR primers for primer information.


References

Original, user report and related articles

reference Kominato, Y., Monocyte expression of the human prointerleukin 1 beta gene (IL1B) is dependent on promoter sequences which bind the hematopoietic transcription factor Spi-1/PU.1. Mol. Cell. Biol. 15 (1): 58-68 (1995). PMID 7799967.
reference Shirakawa, F., The human prointerleukin 1 beta gene requires DNA sequences both proximal and distal to the transcription start site for tissue-specific induction. Mol. Cell. Biol. 13 (3): 1332-1344 (1993). PMID 8441379.
user report Matsushita, A., TAZ activation by Hippo pathway dysregulation induces cytokine gene expression and promotes mesothelial cell transformation. Oncogene 38: 1966–1978 (2019). PMID 30401981.

2019.10.05

GNP_filter3_RDBDEP_html_190927.pl