Resource data sheet
Prev.
Please review the QC test results indicated by check icon below as well as clone information before placing your order.

pKM2L-phKDR

Promoter Bank clone, Human receptor tyrosine (KDR/flk-1) promoter

Catalog number RDB05525
Resource name pKM2L-phKDR
Alternative name p1940-3F
Clone info. PCR amplified human receptor tyrosine (KDR/flk-1) promoter sequence (PCR-amplified 1,083 bp) was inserted into a Renilla luciferase reporter vector pKM2L (RDB04026). Cloned fragment: 55126375 to 55125294(NC_000004.12); relatively -780 to +302, where +1 corresponds to 1 nt of NM_002253.3.
PCR cloning, forward primer, D9PB0068F: 5' cctccttcccctgggcctaaggat 3'; reverse primer, D9PB0068R: 5' cctgcacctcgagccgggcgaaat 3' Entire sequence of promoter region has not been confirmed.
Vector backbone pKM2L (RDB04026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human receptor tyrosine (KDR/flk-1) genomic DNA
Reference of nucleotide sequence X89776 (DDBJ accession number)
Depositor|Developer DNA Bank, |
 
Other clones in our bank human KDR (NCBI Gene 3791) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution.[link] 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Availability Shipping form Fee (non-profit org.)
RDB05525 pKM2L-phKDR Under QC test. Please contact us. DNA solution

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.
Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Original reference

Further references such as user reports and related articles (go to bottom)

Featured content


Sequence information

check Please wait for results of QC test to be uploaded. This clone will be sequenced a portion for examination.


References

Original, user report and related articles


2020.10.02

GNP_filter3_RDBDEP_html_200316.pl