Resource data sheet
Prev.

pKM2L-phMK

Promoter Bank clone, Human midkine (MK) promoter

Catalog number RDB05514
Resource name pKM2L-phMK
Alternative name p1928-13F
Clone info. The Human midkine (MK) promoter sequence (PCR-amplified 2,312 bp) was inserted into a Renilla luciferase reporter vector pKM2L (RDB4026).
Forward primer, H7PB0056F: 5' gatcaggggacgggatggggtac 3'; Reverse primer, 1928 R2: 5' gcttcgctccctcccgcgccgggt 3' Entire sequence of promoter region has not been confirmed.
Vector backbone pKM2L (RDB4026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human midkine (neurite growth-promoting factor 2) genomic DNA
Reference of nucleotide sequence D10604, AC116021 (DDBJ accession number)
Depositor DNA Bank, |
 
Other clones in our bank human MDK (NCBI Gene 4192) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB05514 pKM2L-phMK DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

Featured content Promoter Collection (Renilla Luciferase) (English text)

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References

user report Maldonado AR., Molecular engineering and validation of an oncolytic herpes simplex virus type 1 transcriptionally targeted to midkine-positive tumors. J. Gene. Med., 12, 613-623 (2010). PMID 20603890.

2018.12.10

GNP_filter3_RDBDEP_html_181012.pl