Promoter Bank clone, Human midkine (MK) promoter
Catalog number | RDB05514 |
---|---|
Resource name | pKM2L-phMK |
Alternative name | p1928-13F |
Clone info. | The Human midkine (MK) promoter sequence (PCR-amplified 2,312 bp) was inserted into a Renilla luciferase reporter vector pKM2L (RDB4026). Forward primer, H7PB0056F: 5' gatcaggggacgggatggggtac 3'; Reverse primer, 1928 R2: 5' gcttcgctccctcccgcgccgggt 3' Entire sequence of promoter region has not been confirmed. |
Vector backbone | pKM2L (RDB4026) (Plasmid) |
Size of vector backbone | 4.2 kb |
Selectable markers | Kan^r |
Gene/insert name | Human midkine (neurite growth-promoting factor 2) genomic DNA |
Reference of nucleotide sequence | D10604, AC116021 (DDBJ accession number) |
Depositor | DNA Bank, | |
  | |
Other clones in our bank | human MDK (NCBI Gene 4192) | |
Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR | 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. |
---|---|
Additional terms and conditions for distribution | The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation. |
Ordering | Please visit Information of Request for Distribution. Order form [Credit Card Payment] [Bank Transfer or Check Payment] Material Transfer Agreement (MTA) [Word] |
Catalog # | Resource name | Shipping form | Fee (non-profit org.) |
---|---|---|---|
RDB05514 | pKM2L-phMK | DNA solution |
Electronic file
Featured content
Featured content | Promoter Collection (Renilla Luciferase) (English text) |
---|
References
User reports and related articles (go to bottom)
This clone will be sequenced a portion and digested by restriction enzyme for examination.
References
2018.12.10
GNP_filter3_RDBDEP_html_181012.pl