Resource data sheet
Prev.

pKM2L-phTGFBRII

Promoter Bank clone, Human transforming growth factor-beta type II receptor (TGF-beta RII) promoter

Catalog number RDB05497
Resource name pKM2L-phTGFBRII
Alternative name p1908-3F
Clone info. The Human transforming growth factor-beta type II receptor (TGF-beta RII) promoter sequence (PCR-amplified 1,952 bp) was inserted into a Renilla luciferase reporter vector pKM2L (RDB4026).
Forward primer, 1908 F2: 5' catggaggtgagggaaagcttgc 3'; Reverse primer, 1908 R2: 5' gtgactcactcaacttcaactcagc 3' Entire sequence of promoter region has not been confirmed.
Vector backbone pKM2L (RDB4026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human transforming growth factor-beta type II receptor (TGF-beta RII) genomic DNA
Reference of nucleotide sequence AY675319, AC096921 (DDBJ accession number)
Depositor DNA Bank, |
 
Other clones in our bank human TGFBR2 (NCBI Gene 7048) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB05497 pKM2L-phTGFBRII DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

Featured content Promoter Collection (Renilla Luciferase) (English text)

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References


2018.12.10

GNP_filter3_RDBDEP_html_181012.pl