Resource data sheet
Prev.

pKM2L-phHSP70B'

Promoter Bank clone, Human hsp70B promoter

Catalog number RDB05491
Resource name pKM2L-phHSP70B'
Alternative name p1900-1F
Clone info. The Human hsp70B promoter sequence (PCR-amplified 668 bp) was inserted into a Renilla luciferase reporter vector pKM2L (RDB4026).
Forward primer, 1900 F2: 5' gcaccgtcttaaatcgcggtttgga 3'; Reverse primer, 1900 R2: 5' ctgaagcttcttgtcggatgctgga 3'; Entire sequence of promoter region has not been confirmed. Promoter activity has not been analyzed.
Vector backbone pKM2L (RDB4026) (Plasmid)
Size of vector backbone 4.2 kb
Selectable markers Kan^r
Gene/insert name Human heat shock 70kDa protein 6 (HSP70B') genomic DNA
Reference of nucleotide sequence AL590385 (DDBJ accession number)
Depositor DNA Bank, |
 
Other clones in our bank human HSPA6 (NCBI Gene 3310) |

Distribution information

Please check terms and conditions set forth by the depositor, which are specified in the RIKEN BRC Catalog and/or Web Catalog.
Terms and conditions set forth by the DEPOSITOR 1. The RECIPIENT agrees to use the BIOLOGICAL RESOURCE only for academic research in the non-profit organization. 2. In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested.
Additional terms and conditions for distribution The use of the BIOLOGICAL RESOURCE is restricted to the academic researches conducted by non-profit organization. By using this material, the RECIPIENT agrees to be bound by the conditions of the limited use statement of the Promega Corporation.
Ordering Please visit Information of Request for Distribution. 
Order form 
[Credit Card Payment]  [Bank Transfer or Check Payment]
Material Transfer Agreement (MTA) [Word]
Distribution information (domestic users) [open/close]


Catalog # Resource name Shipping form Fee (non-profit org.)
RDB05491 pKM2L-phHSP70B' DNA solution

Ordering Information [in Japanese] [in English]

References and tips

Electronic file

Featured content

References

User reports and related articles (go to bottom)


Sequence information

This clone will be sequenced a portion and digested by restriction enzyme for examination.


References

References


2018.12.10

GNP_filter3_RDBDEP_html_181012.pl