Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177C12

Clone ID RBdS177C12
HP ID HP04424
Gene ID 27013
Gene Symbol C2orf24
Protein Name chromosome 2 open reading frame 24
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_015680.4
Length of RefSeq (bp) 2100
Chromosome 2q35
Reference DDBJ accession
UniGene Hs.4973
5'-terminal sequence GGCGCCCCGGCGGCTGCCGCTGACACTGCGCCTACACAGGGCGGCGACTGGCGGCGCGAT
2011.08.28