Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156J09

Clone ID RBdS156J09
HP ID HP09244
Gene ID 56998
Gene Symbol CTNNBIP1
Protein Name catenin, beta interacting protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001012329.1
Length of RefSeq (bp) 2961
Chromosome 1p36.22
Reference DDBJ accession
UniGene Hs.463759
5'-terminal sequence GCCCCTCCCCCGGCGGCCTGGCGCCTCCCTCCCTCCCCACCGCGGTGACTCTCGGAGCGG
2011.08.28