Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156H06

Clone ID RBdS156H06
HP ID HP09239
Gene ID 89927
Gene Symbol C16orf45
Protein Name chromosome 16 open reading frame 45
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_033201.2
Length of RefSeq (bp) 2234
Chromosome 16p13.11
Reference DDBJ accession
UniGene Hs.401798
5'-terminal sequence GGGAGAGGGAGCAGCGTCACGGGCGCCCGGCCCGTTAAAACGCTGCTGGCTGGAGCCACC
2011.08.28