Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS156G19

Clone ID RBdS156G19
HP ID HP09238
Gene ID 84312
Gene Symbol BRMS1L
Protein Name breast cancer metastasis-suppressor 1-like
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_032352.3
Length of RefSeq (bp) 2604
Chromosome 14q13.2
Reference DDBJ accession
UniGene Hs.525299
5'-terminal sequence GAGGAGCCAAGGGGGCGAGCAAGCTCGGTGGCTGGGTGGGTTGGGGCGTTCCGCGCGCCC
2011.08.28