Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154H12

Clone ID RBdS154H12
HP ID HP09218
Gene ID 11216
Gene Symbol AKAP10
Protein Name A kinase (PRKA) anchor protein 10
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_007202.2
Length of RefSeq (bp) 2929
Chromosome 17p11.1
Reference DDBJ accession
UniGene Hs.708043
5'-terminal sequence GGCGGGCGGCTTGTTGATAATATGGCGGCTGGAGCTGCCTGGGCATCCCGAGGAGGCGGT
2011.08.28