Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154C10

Clone ID RBdS154C10
HP ID HP04821
Gene ID 25915
Gene Symbol C3orf60
Protein Name chromosome 3 open reading frame 60
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_199069.1
Length of RefSeq (bp) 1387
Chromosome 3p21.31
Reference DDBJ accession
UniGene Hs.31387
5'-terminal sequence GGCCGCGCGTTGGTCAGCCATGGCCACCGCTCTCGCGCTACGTAGCTTGTACCGAGCGCG
2011.08.28