Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110J08

Clone ID RBdS110J08
HP ID HP07618
Gene ID 4968
Gene Symbol OGG1
Protein Name 8-oxoguanine DNA glycosylase
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_002542.5
Length of RefSeq (bp) 1652
Chromosome 3p26.2
Reference DDBJ accession
UniGene Hs.380271
5'-terminal sequence GGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCTGCCCTGTGGGC
2011.08.28