Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110D19

Clone ID RBdS110D19
HP ID HP09158
Gene ID 54980
Gene Symbol C2orf42
Protein Name chromosome 2 open reading frame 42
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_017880.1
Length of RefSeq (bp) 2540
Chromosome 2p14
Reference DDBJ accession
UniGene
5'-terminal sequence GGTTTGTAAAAGGCCGCGGCAGGCGAAGAGAGAAGAGGTGAGGGCGGTCGTCAGCTAAGG
2011.08.28