Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS110C21

Clone ID RBdS110C21
HP ID HP04615
Gene ID 149603
Gene Symbol RNF187
Protein Name ring finger protein 187
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001010858.1
Length of RefSeq (bp) 2685
Chromosome 1q42.13
Reference DDBJ accession
UniGene Hs.356377
5'-terminal sequence GGCGCTGCAGCTGCTGTGCCGCGCCGACGCCGGCCCGCTCTGCGCCGCCTGCCGTATGGC
2011.08.28