Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105N07

Clone ID RBdS105N07
HP ID HP05639
Gene ID 285282
Gene Symbol RABL3
Protein Name RAB, member of RAS oncogene family-like 3
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_173825.3
Length of RefSeq (bp) 3883
Chromosome 3q13.33
Reference DDBJ accession
UniGene Hs.444360
5'-terminal sequence GAGTGGCAAGATGGCGTCCCTGGATCGGGTGAAGGTACTGGTGTTGGGAGACTCAGGTGT
2011.08.28