Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105K06

Clone ID RBdS105K06
HP ID HP03600
Gene ID 100133941
Gene Symbol CD24
Protein Name CD24 molecule
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_013230.2
Length of RefSeq (bp) 2194
Chromosome 6q21
Reference DDBJ accession
UniGene Hs.694721
5'-terminal sequence ACCTTGCCTGCGCCCGCCCGGAGCCAGCGGTTCTCCAAGCACCCAGCATCCTGCTAGACG
2011.08.28