Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105J07

Clone ID RBdS105J07
HP ID HP04390
Gene ID 9184
Gene Symbol BUB3
Protein Name budding uninhibited by benzimidazoles 3 homolog (yeast)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001007793.2
Length of RefSeq (bp) 1555
Chromosome 10q26
Reference DDBJ accession
UniGene Hs.418533
5'-terminal sequence GGCCTAGCCTGCGAGTGTTCTGAGGGAAGCAAGGAGGCGGCGGCGGCCGCAGCGAGTGGC
2011.08.28