Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS105I22

Clone ID RBdS105I22
HP ID HP01147
Gene ID 1528
Gene Symbol CYB5A
Protein Name cytochrome b5 type A (microsomal)
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_148923.2
Length of RefSeq (bp) 820
Chromosome 18q23
Reference DDBJ accession
UniGene Hs.465413
5'-terminal sequence GGGGGTTCCCGGCGCGGGGAATGTCCCGGGTGGAGCTGGCTGAGTCGCGCGCTCTGCTCC
2011.08.28