Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104O18

Clone ID RBdS104O18
HP ID HP00543
Gene ID 6742
Gene Symbol SSBP1
Protein Name single-stranded DNA binding protein 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003143.1
Length of RefSeq (bp) 628
Chromosome 7q34
Reference DDBJ accession
UniGene Hs.490394
5'-terminal sequence TGTTTTGCGTTCCCTGTGCGCCGGAAGTGATCCCCTGCGTGGCTGGGCTGCTCGGGTTAG
2011.08.28