Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104I18

Clone ID RBdS104I18
HP ID HP09109
Gene ID 196500
Gene Symbol C12orf53
Protein Name chromosome 12 open reading frame 53
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_153685.2
Length of RefSeq (bp) 2240
Chromosome 12p13.31
Reference DDBJ accession
UniGene Hs.44067
5'-terminal sequence GATCCCGCCTCGGCTCGGCGGGCGGCTCCGCGCAGTCTCCTGCTTCGGGTCCCCAGTCCG
2011.08.28