Prev. |  Human A to Z list >  O >  OTX2 > 

RBdS104I06 - NRCD Human cDNA Clone

Catalog Number HKR441798
Clone Name RBdS104I06
Clone info. Plasmid clone of human OTX2 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GGCCTTACGCAGTCAATGGGCTGAGTCTGACCACTTCGGGTATGGACTTGCTGCACCCCT
Sequence, submitted(3) AB593057 [link]
Note Partial cds when compared using AB593057
 
Sequence, refered NM_021728.2 (NCBI RefSeq mRNA)
Gene Symbol and ID(4) OTX2 (NCBI Gene 5015)  other clone of OTX2 in our bank
Synonyms CPHD6|MCOPS5
Protein Name orthodenticle homeobox 2
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR441798 RBdS104I06 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBdS104I06 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR441798).

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2023.07.07

NRCDhumcloneList_RB_2023May03.csv - GNP_filter3_NRCD_html_230707.pl