Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104H13

Clone ID RBdS104H13
HP ID HP04363
Gene ID 84418
Gene Symbol C5orf32
Protein Name chromosome 5 open reading frame 32
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_032412.3
Length of RefSeq (bp) 926
Chromosome 5q31.3
Reference DDBJ accession
UniGene Hs.529798
5'-terminal sequence GGCTCTGAGACAGGTGCGGCAAGTCTACTGCGGGCTGGTCCGGGCTCCTCAGGTTCAGAC
2011.08.28