Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083H03

Clone ID RBdS083H03
HP ID HP10120
Gene ID 84191
Gene Symbol FAM96A
Protein Name family with sequence similarity 96, member A
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_032231.4
Length of RefSeq (bp) 1108
Chromosome 15q22.31
Reference DDBJ accession
UniGene Hs.439548
5'-terminal sequence GGCTGCTGAGAGACGGTGGCGCGATTGGGACAGTCGCCAGGGATGGCTGAGCGTGAAGAT
2011.08.28