Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081P12

Clone ID RBdS081P12
HP ID HP00074
Gene ID 2717
Gene Symbol GLA
Protein Name galactosidase, alpha
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_000169.2
Length of RefSeq (bp) 1418
Chromosome Xq22
Reference DDBJ accession
UniGene Hs.69089
5'-terminal sequence GACAATGCAGCTGAGGAACCCAGAACTACATCTGGGCTGCGCGCTTGCGCTTCGCTTCCT
2011.08.28