Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081P01

Clone ID RBdS081P01
HP ID HP04380
Gene ID 9616
Gene Symbol RNF7
Protein Name ring finger protein 7
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014245.3
Length of RefSeq (bp) 1599
Chromosome 3q22-q24
Reference DDBJ accession
UniGene Hs.134623
5'-terminal sequence GGCCGCCATGGCCGACGTGNAAGACGGAGAGGAAACCTGCGCCCTGGCCTCTCACTCCGG
2011.08.28